ID: 1114047538

View in Genome Browser
Species Human (GRCh38)
Location 14:18889973-18889995
Sequence CCATCCAGGAAAACACTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114047532_1114047538 7 Left 1114047532 14:18889943-18889965 CCCAAATCTCCAAGCTTGACGTT No data
Right 1114047538 14:18889973-18889995 CCATCCAGGAAAACACTGGCTGG No data
1114047533_1114047538 6 Left 1114047533 14:18889944-18889966 CCAAATCTCCAAGCTTGACGTTT No data
Right 1114047538 14:18889973-18889995 CCATCCAGGAAAACACTGGCTGG No data
1114047531_1114047538 8 Left 1114047531 14:18889942-18889964 CCCCAAATCTCCAAGCTTGACGT No data
Right 1114047538 14:18889973-18889995 CCATCCAGGAAAACACTGGCTGG No data
1114047534_1114047538 -2 Left 1114047534 14:18889952-18889974 CCAAGCTTGACGTTTTGCTTGCC No data
Right 1114047538 14:18889973-18889995 CCATCCAGGAAAACACTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114047538 Original CRISPR CCATCCAGGAAAACACTGGC TGG Intergenic
No off target data available for this crispr