ID: 1114049658

View in Genome Browser
Species Human (GRCh38)
Location 14:18912910-18912932
Sequence GTGGTGCATCGACCTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114049655_1114049658 -5 Left 1114049655 14:18912892-18912914 CCGCCTGGAGGTCACGCGGTGGT No data
Right 1114049658 14:18912910-18912932 GTGGTGCATCGACCTGAGGAAGG No data
1114049656_1114049658 -8 Left 1114049656 14:18912895-18912917 CCTGGAGGTCACGCGGTGGTGCA No data
Right 1114049658 14:18912910-18912932 GTGGTGCATCGACCTGAGGAAGG No data
1114049649_1114049658 20 Left 1114049649 14:18912867-18912889 CCTAGTGCTTGTCCGGGAGCTGC No data
Right 1114049658 14:18912910-18912932 GTGGTGCATCGACCTGAGGAAGG No data
1114049651_1114049658 8 Left 1114049651 14:18912879-18912901 CCGGGAGCTGCAGCCGCCTGGAG No data
Right 1114049658 14:18912910-18912932 GTGGTGCATCGACCTGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114049658 Original CRISPR GTGGTGCATCGACCTGAGGA AGG Intergenic
No off target data available for this crispr