ID: 1114052718

View in Genome Browser
Species Human (GRCh38)
Location 14:18935106-18935128
Sequence CCTTCCCAGGGTGACTTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114052713_1114052718 4 Left 1114052713 14:18935079-18935101 CCTGAACACTGTATTGGACAGAC No data
Right 1114052718 14:18935106-18935128 CCTTCCCAGGGTGACTTTTGTGG No data
1114052710_1114052718 11 Left 1114052710 14:18935072-18935094 CCAGTTCCCTGAACACTGTATTG No data
Right 1114052718 14:18935106-18935128 CCTTCCCAGGGTGACTTTTGTGG No data
1114052712_1114052718 5 Left 1114052712 14:18935078-18935100 CCCTGAACACTGTATTGGACAGA No data
Right 1114052718 14:18935106-18935128 CCTTCCCAGGGTGACTTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114052718 Original CRISPR CCTTCCCAGGGTGACTTTTG TGG Intergenic
No off target data available for this crispr