ID: 1114054880

View in Genome Browser
Species Human (GRCh38)
Location 14:18959254-18959276
Sequence CCTGATATCCAGAAGTTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114054878_1114054880 -8 Left 1114054878 14:18959239-18959261 CCTTGCTGGAAGTGACCTGATAT No data
Right 1114054880 14:18959254-18959276 CCTGATATCCAGAAGTTTGATGG No data
1114054877_1114054880 -5 Left 1114054877 14:18959236-18959258 CCACCTTGCTGGAAGTGACCTGA No data
Right 1114054880 14:18959254-18959276 CCTGATATCCAGAAGTTTGATGG No data
1114054875_1114054880 8 Left 1114054875 14:18959223-18959245 CCTTCAGGTTTCTCCACCTTGCT No data
Right 1114054880 14:18959254-18959276 CCTGATATCCAGAAGTTTGATGG No data
1114054873_1114054880 23 Left 1114054873 14:18959208-18959230 CCTTTAACTTAATGTCCTTCAGG No data
Right 1114054880 14:18959254-18959276 CCTGATATCCAGAAGTTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114054880 Original CRISPR CCTGATATCCAGAAGTTTGA TGG Intergenic
No off target data available for this crispr