ID: 1114055136

View in Genome Browser
Species Human (GRCh38)
Location 14:18961815-18961837
Sequence TAGAAAATGCAGAAGTAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114055136_1114055138 -1 Left 1114055136 14:18961815-18961837 CCAGGCTACTTCTGCATTTTCTA No data
Right 1114055138 14:18961837-18961859 AACTTGTCTAGGTGAAAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114055136 Original CRISPR TAGAAAATGCAGAAGTAGCC TGG (reversed) Intergenic
No off target data available for this crispr