ID: 1114055551

View in Genome Browser
Species Human (GRCh38)
Location 14:18964828-18964850
Sequence GTGTCCCAGGGCACCCTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114055551_1114055557 -5 Left 1114055551 14:18964828-18964850 CCACTGAGGGTGCCCTGGGACAC No data
Right 1114055557 14:18964846-18964868 GACACAAAGCTGGTGGGAAGAGG No data
1114055551_1114055558 -1 Left 1114055551 14:18964828-18964850 CCACTGAGGGTGCCCTGGGACAC No data
Right 1114055558 14:18964850-18964872 CAAAGCTGGTGGGAAGAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114055551 Original CRISPR GTGTCCCAGGGCACCCTCAG TGG (reversed) Intergenic
No off target data available for this crispr