ID: 1114058166

View in Genome Browser
Species Human (GRCh38)
Location 14:18993395-18993417
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 11, 1: 4, 2: 1, 3: 10, 4: 101}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907239700 1:53074660-53074682 CAAGCCCCTCACCTTGTTATTGG - Exonic
910675728 1:89814805-89814827 CATGCAACTCACATTGAAATAGG - Intronic
914887715 1:151599074-151599096 CAAGCTCCTCACACTGGGATGGG + Intergenic
916986075 1:170192299-170192321 CATGCTTCTCCCATTGATCTTGG - Intergenic
918227451 1:182497168-182497190 GAAGCAGTTCACATTGATGTAGG - Intronic
918558457 1:185834392-185834414 CAAGCTACTCACATGGTTGTTGG + Intronic
1063170268 10:3503519-3503541 CAAGCTGCCCACTTTGAAAATGG + Intergenic
1064548549 10:16475507-16475529 GAAGCTGCTTCCAATGATATGGG + Intronic
1068301830 10:55153337-55153359 CAAGTTGCTCACCTTGACACGGG + Intronic
1070461213 10:76672295-76672317 CAGTCTCCTCACAGTGATATAGG - Intergenic
1070869182 10:79733646-79733668 CAAGGTTCACACATTGAGATTGG + Intergenic
1071636096 10:87255823-87255845 CAAGGTTCACACATTGAGATTGG + Intergenic
1071659145 10:87482123-87482145 CAAGGTTCACACATTGAGATTGG - Intergenic
1081240086 11:40694781-40694803 CACACTGCACAAATTGATATAGG + Intronic
1085750231 11:79155099-79155121 CAAGCTACTCACTTGGATAATGG - Intronic
1087205721 11:95391900-95391922 CAACCTGAGCACACTGATATGGG + Intergenic
1091640322 12:2231092-2231114 GCAGGTGCTCACATGGATATGGG - Intronic
1093970028 12:25367845-25367867 CAAGCAACTCACATTAAAATGGG - Intergenic
1098115481 12:67171972-67171994 CAAGATGCTCATATTGATGAGGG - Intergenic
1102443270 12:112979654-112979676 CAAGCTGGACACTTTGATCTGGG - Intronic
1104052702 12:125206812-125206834 CAAGTTTCTCACATTGATGAAGG - Intronic
1104351195 12:128045411-128045433 CGAGCTGCAGACATAGATATTGG - Intergenic
1113886486 13:113662859-113662881 CAATCTCCCCAAATTGATATAGG + Intergenic
1114058166 14:18993395-18993417 CAAGCTGCTCACATTGATATTGG + Intronic
1114104381 14:19408359-19408381 CAAGCTGCTCACATTGATATTGG - Intronic
1114907151 14:27144246-27144268 CAAGCTGGTCGCTCTGATATGGG - Intergenic
1123497288 15:20840946-20840968 CAAGCTGCTCACATTGATATTGG - Intronic
1123554523 15:21414585-21414607 TAAGCTGCTCACATTGATATTGG - Intronic
1123590767 15:21851899-21851921 CAAGCTGCTCACATTGATATTGG - Intergenic
1130762233 15:86832664-86832686 CAAAATGCTGACAGTGATATGGG - Intronic
1202962868 15_KI270727v1_random:141778-141800 CAAGCTGCTCACATTGATATTGG - Intergenic
1133041749 16:3064719-3064741 CACGCTGCCCACATTGACCTTGG + Intergenic
1139072559 16:63401104-63401126 CTAGCTGCCCTTATTGATATAGG - Intergenic
1140238387 16:73179584-73179606 CAAACTGCTCACGTGGAAATTGG + Intergenic
1144096581 17:11905450-11905472 CGAGCTGCTCACCTGGATCTGGG - Intronic
1144611042 17:16715910-16715932 CAAGTGGCGCACGTTGATATTGG + Intronic
1144901695 17:18599453-18599475 CAAGTGGCCCACATTGATATTGG - Intergenic
1144929377 17:18846607-18846629 CAAGTGGCCCACATTGATATTGG + Intronic
1145130809 17:20346614-20346636 CAAGTGGTCCACATTGATATTGG + Intergenic
1150465387 17:65388353-65388375 CCAGCTGCTCTCATTTTTATAGG - Intergenic
1154455310 18:14517354-14517376 CAAGCTGCTCACATTGATATTGG - Intronic
1155324120 18:24648990-24649012 AAAGCAGTTCACATTCATATGGG - Intergenic
1158115239 18:53987828-53987850 CAAGATACTGACATTCATATAGG - Intergenic
1162321071 19:9970815-9970837 CAAGCTGCTCACATTCCTGGGGG + Intronic
1166740074 19:45109313-45109335 CAAGCTGTTCACACTGAGATGGG - Intronic
1166948306 19:46410739-46410761 CAAGGTGCTCAGCTTGATAAAGG - Exonic
1168198242 19:54791568-54791590 CATGATGCTCACATTGCTGTGGG + Intronic
927786631 2:25979411-25979433 CTTGCTGCTCAGATTAATATAGG + Intronic
929081501 2:38126948-38126970 CAAAATGCTCATAGTGATATGGG + Intergenic
929612688 2:43283485-43283507 CAAAATGCTGACAGTGATATGGG + Intronic
931655428 2:64507011-64507033 CAAGATGCTAACATTGGTAATGG + Intergenic
936724540 2:115297126-115297148 CATGCTGCTCACATAGAAAATGG - Intronic
937799658 2:126068045-126068067 CAACCTGCTCACAATGTTATTGG - Intergenic
938283045 2:130080844-130080866 CAAGCTGCTCACACTGATATTGG - Intronic
938333673 2:130469394-130469416 CAGGCTGCTCACACTGATATTGG - Intronic
938356141 2:130651273-130651295 CAAGCTGCTCACACTGATATTGG + Intronic
938432565 2:131258055-131258077 CAAGCTGCTCACACTGATATTGG + Intronic
938476575 2:131620335-131620357 CAAGCTGCTCACATTGATATTGG + Intergenic
939582792 2:143970290-143970312 AATCCTGCTCACATTGGTATTGG - Intronic
942219638 2:173756619-173756641 CAAGCTGGTCACAGTGACATAGG + Intergenic
944320488 2:198335427-198335449 CAGGCTGCTCACATTGATCAGGG - Intronic
1170102700 20:12720002-12720024 CAAGGTGGTCACATTGGGATGGG + Intergenic
1172056521 20:32158107-32158129 CAACCTGGTCACCTTGATCTTGG - Intronic
1176818859 21:13635958-13635980 CAAGCTGCTCACATTGATATTGG + Intronic
1178635095 21:34295411-34295433 TAAGTTACTCACATTGGTATTGG + Intergenic
1180476653 22:15716011-15716033 CAAGCTGCTCACATTGATATTGG + Intronic
1180685776 22:17665327-17665349 CAAAATGCTGACAGTGATATGGG - Intronic
1185395529 22:50585305-50585327 AAAGCAGTTCACATTTATATGGG + Intronic
951174220 3:19580188-19580210 CAACCTTCTCACATGGCTATGGG - Intergenic
955475057 3:59327961-59327983 CAAGATGCTCTCAATGATAATGG - Intergenic
958065071 3:88534268-88534290 TAAGCAGCTCACATTAATCTGGG - Intergenic
959633603 3:108536547-108536569 AAAGGTGCTAACATTGATAATGG + Intergenic
960029500 3:113043054-113043076 GAAGCTGCTTACAGAGATATAGG + Intergenic
966300715 3:178476678-178476700 CAAGCTACTCCCCTTGAAATAGG + Intronic
968291311 3:197541864-197541886 CCAGCTGTTCACAGGGATATTGG - Intronic
970104979 4:12571947-12571969 CAAGCTGCTCACCTGCATCTTGG + Intergenic
970604729 4:17668325-17668347 CAAGCTACTAAGAATGATATAGG - Intronic
974300526 4:60060105-60060127 TACACTGCTCACATTCATATGGG + Intergenic
975891904 4:79039754-79039776 CAGACTGCTTATATTGATATTGG + Intergenic
978245601 4:106568838-106568860 CAAGCTGCTCTTAGTGATTTGGG - Intergenic
983138793 4:164122350-164122372 CAAGCTGCAGACATAGATATTGG + Intronic
988530749 5:32025170-32025192 CAAGGAGCTCATATTGATCTGGG + Intronic
993407332 5:87527760-87527782 CAAGCTCTTAACAGTGATATGGG - Intergenic
994517807 5:100793453-100793475 CTAGATGGTCACATAGATATTGG - Intergenic
995952164 5:117729345-117729367 CAACCTGCTCAAATTTAGATCGG - Intergenic
1000378219 5:160603990-160604012 CAAGCTGCTGATATTGGAATTGG - Exonic
1000712186 5:164594540-164594562 CAAGCTTCTCTCATTAATTTAGG - Intergenic
1003670185 6:8150008-8150030 CAACCTTCTCACTTTGAAATGGG + Intergenic
1004275039 6:14228659-14228681 CAAGCTGCACACTCTGATGTGGG + Intergenic
1007930241 6:45684314-45684336 CAAACTGCTCAAAGTCATATAGG + Intergenic
1008376201 6:50794953-50794975 CCAGCTGGTCACATTTTTATGGG - Intergenic
1008617075 6:53237025-53237047 CAAGCTGATCAGATTTATTTGGG - Intergenic
1009657191 6:66562321-66562343 CAAGCTACCCACATAGATACTGG - Intergenic
1010800091 6:80165281-80165303 CAAGCTACTCACAGTCAAATAGG + Intronic
1010945055 6:81964209-81964231 CATGCTGAACACATTGAAATTGG - Intergenic
1011904093 6:92339330-92339352 CAAGATTCTCATTTTGATATGGG - Intergenic
1012765499 6:103362467-103362489 CAAAATGCTCATAGTGATATGGG + Intergenic
1013815757 6:114095439-114095461 CAAGATGCTCACATGAATATGGG + Intronic
1016294560 6:142561135-142561157 CAAGCTGCTCTCAGAGACATGGG + Intergenic
1020579420 7:9976190-9976212 CAATATGCTAACATTAATATTGG - Intergenic
1020933269 7:14427337-14427359 CAAACTGCTGATAGTGATATGGG - Intronic
1020953575 7:14710570-14710592 GAAGTTTCTCTCATTGATATTGG - Intronic
1023406616 7:39840498-39840520 CAAGCTGCTCACACTGATGCTGG + Intergenic
1027448431 7:78301723-78301745 AAAGCTGCTGAGATTGGTATTGG - Intronic
1028201553 7:87967865-87967887 CAAGGTGCTTACAGAGATATTGG + Intronic
1028840287 7:95422211-95422233 AAAGCTGCTCACACTGTTTTAGG + Intronic
1030096085 7:105901199-105901221 CAAGTTGCTCTCATTCTTATTGG + Intronic
1040085498 8:43336014-43336036 CAAGCTGCTCACATTGATATTGG + Intergenic
1046668917 8:117036246-117036268 CAAAATGCTGACAGTGATATGGG - Intronic
1046758593 8:117996865-117996887 CAAGCAGCTAACATTTTTATAGG + Intronic
1046833858 8:118777770-118777792 CAAGCTGGTCACTTATATATGGG - Intergenic
1047413238 8:124641278-124641300 CAAGTTGCTCACAGGTATATGGG - Intronic
1050301276 9:4261256-4261278 AGAGCTGCTCACATTGAATTGGG - Intronic
1055933083 9:81579901-81579923 AAAGCTGAGAACATTGATATGGG - Intergenic
1057285435 9:93749742-93749764 CAAACTGCTGATAGTGATATGGG - Intergenic
1058895723 9:109399040-109399062 CAAACTGCTCCCATTGATGTAGG + Intronic
1059254795 9:112919893-112919915 CAAGTTGGTCACATTCATCTGGG - Intergenic
1061094661 9:128448691-128448713 CCAGCTGCTCATTTGGATATAGG + Intergenic
1203528498 Un_GL000213v1:113547-113569 CAAGCTGCTCACATTGATATTGG - Intergenic
1187704420 X:21995245-21995267 CAAGTTGCTCATATTGCCATAGG - Intergenic
1188816004 X:34715091-34715113 TAAGCTCCAGACATTGATATTGG + Intergenic
1198911860 X:141624001-141624023 CAAGCTTCTCATATTGTTTTTGG - Intronic
1199618949 X:149682141-149682163 CAAGCTTCTCTCATTCATCTGGG + Intergenic
1201760941 Y:17537372-17537394 CAAGCTCCCAACATTGAGATGGG + Intergenic
1201840611 Y:18368618-18368640 CAAGCTCCCAACATTGAGATGGG - Intergenic
1202339663 Y:23849811-23849833 CAAGCTGATAAAATTGCTATTGG + Intergenic
1202531103 Y:25820271-25820293 CAAGCTGATAAAATTGCTATTGG - Intergenic