ID: 1114060671

View in Genome Browser
Species Human (GRCh38)
Location 14:19013766-19013788
Sequence GGCGCTGTAGCCCAACTTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114060664_1114060671 20 Left 1114060664 14:19013723-19013745 CCACCTAACTGCTGATGGAGCAG No data
Right 1114060671 14:19013766-19013788 GGCGCTGTAGCCCAACTTTAGGG No data
1114060662_1114060671 29 Left 1114060662 14:19013714-19013736 CCTTGGCTGCCACCTAACTGCTG No data
Right 1114060671 14:19013766-19013788 GGCGCTGTAGCCCAACTTTAGGG No data
1114060669_1114060671 -6 Left 1114060669 14:19013749-19013771 CCTTAGGAAAAGCAAATGGCGCT No data
Right 1114060671 14:19013766-19013788 GGCGCTGTAGCCCAACTTTAGGG No data
1114060665_1114060671 17 Left 1114060665 14:19013726-19013748 CCTAACTGCTGATGGAGCAGCGG No data
Right 1114060671 14:19013766-19013788 GGCGCTGTAGCCCAACTTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114060671 Original CRISPR GGCGCTGTAGCCCAACTTTA GGG Intergenic
No off target data available for this crispr