ID: 1114062375

View in Genome Browser
Species Human (GRCh38)
Location 14:19029993-19030015
Sequence GGGCAATAACAAATGCTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114062375_1114062378 8 Left 1114062375 14:19029993-19030015 CCTGCTAGCATTTGTTATTGCCC No data
Right 1114062378 14:19030024-19030046 CATACAAGTCATATAAACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114062375 Original CRISPR GGGCAATAACAAATGCTAGC AGG (reversed) Intergenic
No off target data available for this crispr