ID: 1114062954

View in Genome Browser
Species Human (GRCh38)
Location 14:19037348-19037370
Sequence AGCACCGGAGGACTCCTACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114062954_1114062958 -2 Left 1114062954 14:19037348-19037370 CCGTGTAGGAGTCCTCCGGTGCT No data
Right 1114062958 14:19037369-19037391 CTGGAGTCCAGAGCACAGTGAGG No data
1114062954_1114062959 2 Left 1114062954 14:19037348-19037370 CCGTGTAGGAGTCCTCCGGTGCT No data
Right 1114062959 14:19037373-19037395 AGTCCAGAGCACAGTGAGGCTGG No data
1114062954_1114062963 26 Left 1114062954 14:19037348-19037370 CCGTGTAGGAGTCCTCCGGTGCT No data
Right 1114062963 14:19037397-19037419 TCCTCCCGTGCCATAGTGTAGGG No data
1114062954_1114062960 3 Left 1114062954 14:19037348-19037370 CCGTGTAGGAGTCCTCCGGTGCT No data
Right 1114062960 14:19037374-19037396 GTCCAGAGCACAGTGAGGCTGGG No data
1114062954_1114062962 25 Left 1114062954 14:19037348-19037370 CCGTGTAGGAGTCCTCCGGTGCT No data
Right 1114062962 14:19037396-19037418 GTCCTCCCGTGCCATAGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114062954 Original CRISPR AGCACCGGAGGACTCCTACA CGG (reversed) Intergenic
No off target data available for this crispr