ID: 1114062956

View in Genome Browser
Species Human (GRCh38)
Location 14:19037360-19037382
Sequence GCTCTGGACTCCAGCACCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114062956_1114062960 -9 Left 1114062956 14:19037360-19037382 CCTCCGGTGCTGGAGTCCAGAGC No data
Right 1114062960 14:19037374-19037396 GTCCAGAGCACAGTGAGGCTGGG No data
1114062956_1114062962 13 Left 1114062956 14:19037360-19037382 CCTCCGGTGCTGGAGTCCAGAGC No data
Right 1114062962 14:19037396-19037418 GTCCTCCCGTGCCATAGTGTAGG No data
1114062956_1114062972 29 Left 1114062956 14:19037360-19037382 CCTCCGGTGCTGGAGTCCAGAGC No data
Right 1114062972 14:19037412-19037434 GTGTAGGGCATGGCGGGACAGGG No data
1114062956_1114062971 28 Left 1114062956 14:19037360-19037382 CCTCCGGTGCTGGAGTCCAGAGC No data
Right 1114062971 14:19037411-19037433 AGTGTAGGGCATGGCGGGACAGG No data
1114062956_1114062967 19 Left 1114062956 14:19037360-19037382 CCTCCGGTGCTGGAGTCCAGAGC No data
Right 1114062967 14:19037402-19037424 CCGTGCCATAGTGTAGGGCATGG No data
1114062956_1114062963 14 Left 1114062956 14:19037360-19037382 CCTCCGGTGCTGGAGTCCAGAGC No data
Right 1114062963 14:19037397-19037419 TCCTCCCGTGCCATAGTGTAGGG No data
1114062956_1114062959 -10 Left 1114062956 14:19037360-19037382 CCTCCGGTGCTGGAGTCCAGAGC No data
Right 1114062959 14:19037373-19037395 AGTCCAGAGCACAGTGAGGCTGG No data
1114062956_1114062968 22 Left 1114062956 14:19037360-19037382 CCTCCGGTGCTGGAGTCCAGAGC No data
Right 1114062968 14:19037405-19037427 TGCCATAGTGTAGGGCATGGCGG No data
1114062956_1114062969 23 Left 1114062956 14:19037360-19037382 CCTCCGGTGCTGGAGTCCAGAGC No data
Right 1114062969 14:19037406-19037428 GCCATAGTGTAGGGCATGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114062956 Original CRISPR GCTCTGGACTCCAGCACCGG AGG (reversed) Intergenic
No off target data available for this crispr