ID: 1114062957

View in Genome Browser
Species Human (GRCh38)
Location 14:19037363-19037385
Sequence TGTGCTCTGGACTCCAGCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114062957_1114062963 11 Left 1114062957 14:19037363-19037385 CCGGTGCTGGAGTCCAGAGCACA No data
Right 1114062963 14:19037397-19037419 TCCTCCCGTGCCATAGTGTAGGG No data
1114062957_1114062969 20 Left 1114062957 14:19037363-19037385 CCGGTGCTGGAGTCCAGAGCACA No data
Right 1114062969 14:19037406-19037428 GCCATAGTGTAGGGCATGGCGGG No data
1114062957_1114062962 10 Left 1114062957 14:19037363-19037385 CCGGTGCTGGAGTCCAGAGCACA No data
Right 1114062962 14:19037396-19037418 GTCCTCCCGTGCCATAGTGTAGG No data
1114062957_1114062968 19 Left 1114062957 14:19037363-19037385 CCGGTGCTGGAGTCCAGAGCACA No data
Right 1114062968 14:19037405-19037427 TGCCATAGTGTAGGGCATGGCGG No data
1114062957_1114062967 16 Left 1114062957 14:19037363-19037385 CCGGTGCTGGAGTCCAGAGCACA No data
Right 1114062967 14:19037402-19037424 CCGTGCCATAGTGTAGGGCATGG No data
1114062957_1114062972 26 Left 1114062957 14:19037363-19037385 CCGGTGCTGGAGTCCAGAGCACA No data
Right 1114062972 14:19037412-19037434 GTGTAGGGCATGGCGGGACAGGG No data
1114062957_1114062971 25 Left 1114062957 14:19037363-19037385 CCGGTGCTGGAGTCCAGAGCACA No data
Right 1114062971 14:19037411-19037433 AGTGTAGGGCATGGCGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114062957 Original CRISPR TGTGCTCTGGACTCCAGCAC CGG (reversed) Intergenic
No off target data available for this crispr