ID: 1114062962

View in Genome Browser
Species Human (GRCh38)
Location 14:19037396-19037418
Sequence GTCCTCCCGTGCCATAGTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114062956_1114062962 13 Left 1114062956 14:19037360-19037382 CCTCCGGTGCTGGAGTCCAGAGC No data
Right 1114062962 14:19037396-19037418 GTCCTCCCGTGCCATAGTGTAGG No data
1114062961_1114062962 -3 Left 1114062961 14:19037376-19037398 CCAGAGCACAGTGAGGCTGGGTC No data
Right 1114062962 14:19037396-19037418 GTCCTCCCGTGCCATAGTGTAGG No data
1114062957_1114062962 10 Left 1114062957 14:19037363-19037385 CCGGTGCTGGAGTCCAGAGCACA No data
Right 1114062962 14:19037396-19037418 GTCCTCCCGTGCCATAGTGTAGG No data
1114062954_1114062962 25 Left 1114062954 14:19037348-19037370 CCGTGTAGGAGTCCTCCGGTGCT No data
Right 1114062962 14:19037396-19037418 GTCCTCCCGTGCCATAGTGTAGG No data
1114062953_1114062962 28 Left 1114062953 14:19037345-19037367 CCTCCGTGTAGGAGTCCTCCGGT No data
Right 1114062962 14:19037396-19037418 GTCCTCCCGTGCCATAGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114062962 Original CRISPR GTCCTCCCGTGCCATAGTGT AGG Intergenic
No off target data available for this crispr