ID: 1114064314

View in Genome Browser
Species Human (GRCh38)
Location 14:19048011-19048033
Sequence TGAGTTGTCGATTTGTTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114064314_1114064316 -5 Left 1114064314 14:19048011-19048033 CCCAGCAACAAATCGACAACTCA No data
Right 1114064316 14:19048029-19048051 ACTCAGCCAGCACTAAAAGTTGG No data
1114064314_1114064317 -4 Left 1114064314 14:19048011-19048033 CCCAGCAACAAATCGACAACTCA No data
Right 1114064317 14:19048030-19048052 CTCAGCCAGCACTAAAAGTTGGG No data
1114064314_1114064320 29 Left 1114064314 14:19048011-19048033 CCCAGCAACAAATCGACAACTCA No data
Right 1114064320 14:19048063-19048085 ATTAAAAGAAAAATGTATCAAGG No data
1114064314_1114064318 -3 Left 1114064314 14:19048011-19048033 CCCAGCAACAAATCGACAACTCA No data
Right 1114064318 14:19048031-19048053 TCAGCCAGCACTAAAAGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114064314 Original CRISPR TGAGTTGTCGATTTGTTGCT GGG (reversed) Intergenic
No off target data available for this crispr