ID: 1114064317

View in Genome Browser
Species Human (GRCh38)
Location 14:19048030-19048052
Sequence CTCAGCCAGCACTAAAAGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114064314_1114064317 -4 Left 1114064314 14:19048011-19048033 CCCAGCAACAAATCGACAACTCA No data
Right 1114064317 14:19048030-19048052 CTCAGCCAGCACTAAAAGTTGGG No data
1114064315_1114064317 -5 Left 1114064315 14:19048012-19048034 CCAGCAACAAATCGACAACTCAG No data
Right 1114064317 14:19048030-19048052 CTCAGCCAGCACTAAAAGTTGGG No data
1114064313_1114064317 0 Left 1114064313 14:19048007-19048029 CCATCCCAGCAACAAATCGACAA No data
Right 1114064317 14:19048030-19048052 CTCAGCCAGCACTAAAAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114064317 Original CRISPR CTCAGCCAGCACTAAAAGTT GGG Intergenic
No off target data available for this crispr