ID: 1114067042

View in Genome Browser
Species Human (GRCh38)
Location 14:19069565-19069587
Sequence GGGTGGGTCATTTCAAAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114067035_1114067042 0 Left 1114067035 14:19069542-19069564 CCAACCATGTGCGGACGGACATG No data
Right 1114067042 14:19069565-19069587 GGGTGGGTCATTTCAAAGTGAGG No data
1114067039_1114067042 -4 Left 1114067039 14:19069546-19069568 CCATGTGCGGACGGACATGGGGT No data
Right 1114067042 14:19069565-19069587 GGGTGGGTCATTTCAAAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114067042 Original CRISPR GGGTGGGTCATTTCAAAGTG AGG Intergenic
No off target data available for this crispr