ID: 1114069729

View in Genome Browser
Species Human (GRCh38)
Location 14:19097558-19097580
Sequence TGCGACTCGGGACCCCCAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114069729_1114069743 22 Left 1114069729 14:19097558-19097580 CCGGCTGGGGGTCCCGAGTCGCA No data
Right 1114069743 14:19097603-19097625 CCGACCCGGAGGGAACGCCCTGG No data
1114069729_1114069744 23 Left 1114069729 14:19097558-19097580 CCGGCTGGGGGTCCCGAGTCGCA No data
Right 1114069744 14:19097604-19097626 CGACCCGGAGGGAACGCCCTGGG No data
1114069729_1114069737 11 Left 1114069729 14:19097558-19097580 CCGGCTGGGGGTCCCGAGTCGCA No data
Right 1114069737 14:19097592-19097614 AGCCCTGGCCACCGACCCGGAGG No data
1114069729_1114069736 8 Left 1114069729 14:19097558-19097580 CCGGCTGGGGGTCCCGAGTCGCA No data
Right 1114069736 14:19097589-19097611 GCAAGCCCTGGCCACCGACCCGG No data
1114069729_1114069747 29 Left 1114069729 14:19097558-19097580 CCGGCTGGGGGTCCCGAGTCGCA No data
Right 1114069747 14:19097610-19097632 GGAGGGAACGCCCTGGGCTACGG No data
1114069729_1114069738 12 Left 1114069729 14:19097558-19097580 CCGGCTGGGGGTCCCGAGTCGCA No data
Right 1114069738 14:19097593-19097615 GCCCTGGCCACCGACCCGGAGGG No data
1114069729_1114069732 -4 Left 1114069729 14:19097558-19097580 CCGGCTGGGGGTCCCGAGTCGCA No data
Right 1114069732 14:19097577-19097599 CGCACACGCCCCGCAAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114069729 Original CRISPR TGCGACTCGGGACCCCCAGC CGG (reversed) Intergenic
No off target data available for this crispr