ID: 1114070967

View in Genome Browser
Species Human (GRCh38)
Location 14:19106518-19106540
Sequence CTAAGACTCCCTGAAGGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114070967_1114070971 -4 Left 1114070967 14:19106518-19106540 CCTGCGCCTTCAGGGAGTCTTAG No data
Right 1114070971 14:19106537-19106559 TTAGTCTTTTTGCTGGTGAAGGG No data
1114070967_1114070972 16 Left 1114070967 14:19106518-19106540 CCTGCGCCTTCAGGGAGTCTTAG No data
Right 1114070972 14:19106557-19106579 GGGTCTTGCCTTGATGTTGTTGG No data
1114070967_1114070970 -5 Left 1114070967 14:19106518-19106540 CCTGCGCCTTCAGGGAGTCTTAG No data
Right 1114070970 14:19106536-19106558 CTTAGTCTTTTTGCTGGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114070967 Original CRISPR CTAAGACTCCCTGAAGGCGC AGG (reversed) Intergenic
No off target data available for this crispr