ID: 1114073409

View in Genome Browser
Species Human (GRCh38)
Location 14:19132776-19132798
Sequence TCCTAGTGGTGCCGGCGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114073396_1114073409 26 Left 1114073396 14:19132727-19132749 CCTGAGGCGCTGGCGGTTGCAGC No data
Right 1114073409 14:19132776-19132798 TCCTAGTGGTGCCGGCGCCCAGG No data
1114073404_1114073409 -6 Left 1114073404 14:19132759-19132781 CCGTTCCGAACCTCGACTCCTAG No data
Right 1114073409 14:19132776-19132798 TCCTAGTGGTGCCGGCGCCCAGG No data
1114073395_1114073409 27 Left 1114073395 14:19132726-19132748 CCCTGAGGCGCTGGCGGTTGCAG No data
Right 1114073409 14:19132776-19132798 TCCTAGTGGTGCCGGCGCCCAGG No data
1114073402_1114073409 3 Left 1114073402 14:19132750-19132772 CCCGGGGGTCCGTTCCGAACCTC No data
Right 1114073409 14:19132776-19132798 TCCTAGTGGTGCCGGCGCCCAGG No data
1114073401_1114073409 4 Left 1114073401 14:19132749-19132771 CCCCGGGGGTCCGTTCCGAACCT No data
Right 1114073409 14:19132776-19132798 TCCTAGTGGTGCCGGCGCCCAGG No data
1114073403_1114073409 2 Left 1114073403 14:19132751-19132773 CCGGGGGTCCGTTCCGAACCTCG No data
Right 1114073409 14:19132776-19132798 TCCTAGTGGTGCCGGCGCCCAGG No data
1114073394_1114073409 28 Left 1114073394 14:19132725-19132747 CCCCTGAGGCGCTGGCGGTTGCA No data
Right 1114073409 14:19132776-19132798 TCCTAGTGGTGCCGGCGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114073409 Original CRISPR TCCTAGTGGTGCCGGCGCCC AGG Intergenic
No off target data available for this crispr