ID: 1114080774

View in Genome Browser
Species Human (GRCh38)
Location 14:19200273-19200295
Sequence CAGAGGACACAGAAGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114080760_1114080774 21 Left 1114080760 14:19200229-19200251 CCCTGCATCCAGGAGGGCCTTGG No data
Right 1114080774 14:19200273-19200295 CAGAGGACACAGAAGGAGGGAGG No data
1114080767_1114080774 4 Left 1114080767 14:19200246-19200268 CCTTGGCTTCCTGGGCTGTGGCC 0: 1
1: 1
2: 2
3: 74
4: 599
Right 1114080774 14:19200273-19200295 CAGAGGACACAGAAGGAGGGAGG No data
1114080756_1114080774 30 Left 1114080756 14:19200220-19200242 CCCAGGATGCCCTGCATCCAGGA No data
Right 1114080774 14:19200273-19200295 CAGAGGACACAGAAGGAGGGAGG No data
1114080757_1114080774 29 Left 1114080757 14:19200221-19200243 CCAGGATGCCCTGCATCCAGGAG No data
Right 1114080774 14:19200273-19200295 CAGAGGACACAGAAGGAGGGAGG No data
1114080768_1114080774 -5 Left 1114080768 14:19200255-19200277 CCTGGGCTGTGGCCTGCACAGAG 0: 1
1: 2
2: 2
3: 53
4: 504
Right 1114080774 14:19200273-19200295 CAGAGGACACAGAAGGAGGGAGG No data
1114080763_1114080774 13 Left 1114080763 14:19200237-19200259 CCAGGAGGGCCTTGGCTTCCTGG No data
Right 1114080774 14:19200273-19200295 CAGAGGACACAGAAGGAGGGAGG No data
1114080762_1114080774 20 Left 1114080762 14:19200230-19200252 CCTGCATCCAGGAGGGCCTTGGC No data
Right 1114080774 14:19200273-19200295 CAGAGGACACAGAAGGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114080774 Original CRISPR CAGAGGACACAGAAGGAGGG AGG Intergenic
No off target data available for this crispr