ID: 1114081083

View in Genome Browser
Species Human (GRCh38)
Location 14:19201750-19201772
Sequence TGATTTCTGAACTAACACCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114081080_1114081083 18 Left 1114081080 14:19201709-19201731 CCTGCGTGAGCTTAATCTCAAAG No data
Right 1114081083 14:19201750-19201772 TGATTTCTGAACTAACACCCGGG No data
1114081079_1114081083 19 Left 1114081079 14:19201708-19201730 CCCTGCGTGAGCTTAATCTCAAA No data
Right 1114081083 14:19201750-19201772 TGATTTCTGAACTAACACCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114081083 Original CRISPR TGATTTCTGAACTAACACCC GGG Intergenic
No off target data available for this crispr