ID: 1114088857

View in Genome Browser
Species Human (GRCh38)
Location 14:19267207-19267229
Sequence TCCTAGTGGTGCCGGCGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114088857_1114088863 2 Left 1114088857 14:19267207-19267229 CCTGGGCGCCGGCACCACTAGGA No data
Right 1114088863 14:19267232-19267254 CGAGGTTCGGAACGGACCCCCGG No data
1114088857_1114088865 4 Left 1114088857 14:19267207-19267229 CCTGGGCGCCGGCACCACTAGGA No data
Right 1114088865 14:19267234-19267256 AGGTTCGGAACGGACCCCCGGGG No data
1114088857_1114088871 27 Left 1114088857 14:19267207-19267229 CCTGGGCGCCGGCACCACTAGGA No data
Right 1114088871 14:19267257-19267279 CTGCAACCGCCAGCGCCTCAGGG No data
1114088857_1114088862 -6 Left 1114088857 14:19267207-19267229 CCTGGGCGCCGGCACCACTAGGA No data
Right 1114088862 14:19267224-19267246 CTAGGAGTCGAGGTTCGGAACGG No data
1114088857_1114088870 26 Left 1114088857 14:19267207-19267229 CCTGGGCGCCGGCACCACTAGGA No data
Right 1114088870 14:19267256-19267278 GCTGCAACCGCCAGCGCCTCAGG No data
1114088857_1114088872 28 Left 1114088857 14:19267207-19267229 CCTGGGCGCCGGCACCACTAGGA No data
Right 1114088872 14:19267258-19267280 TGCAACCGCCAGCGCCTCAGGGG No data
1114088857_1114088864 3 Left 1114088857 14:19267207-19267229 CCTGGGCGCCGGCACCACTAGGA No data
Right 1114088864 14:19267233-19267255 GAGGTTCGGAACGGACCCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114088857 Original CRISPR TCCTAGTGGTGCCGGCGCCC AGG (reversed) Intergenic
No off target data available for this crispr