ID: 1114088862

View in Genome Browser
Species Human (GRCh38)
Location 14:19267224-19267246
Sequence CTAGGAGTCGAGGTTCGGAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114088848_1114088862 26 Left 1114088848 14:19267175-19267197 CCGGGCTTCACGCTGCCGCCGCT No data
Right 1114088862 14:19267224-19267246 CTAGGAGTCGAGGTTCGGAACGG No data
1114088857_1114088862 -6 Left 1114088857 14:19267207-19267229 CCTGGGCGCCGGCACCACTAGGA No data
Right 1114088862 14:19267224-19267246 CTAGGAGTCGAGGTTCGGAACGG No data
1114088852_1114088862 11 Left 1114088852 14:19267190-19267212 CCGCCGCTGAGAGGCGGCCTGGG No data
Right 1114088862 14:19267224-19267246 CTAGGAGTCGAGGTTCGGAACGG No data
1114088854_1114088862 8 Left 1114088854 14:19267193-19267215 CCGCTGAGAGGCGGCCTGGGCGC No data
Right 1114088862 14:19267224-19267246 CTAGGAGTCGAGGTTCGGAACGG No data
1114088847_1114088862 29 Left 1114088847 14:19267172-19267194 CCGCCGGGCTTCACGCTGCCGCC No data
Right 1114088862 14:19267224-19267246 CTAGGAGTCGAGGTTCGGAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114088862 Original CRISPR CTAGGAGTCGAGGTTCGGAA CGG Intergenic
No off target data available for this crispr