ID: 1114088864

View in Genome Browser
Species Human (GRCh38)
Location 14:19267233-19267255
Sequence GAGGTTCGGAACGGACCCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114088854_1114088864 17 Left 1114088854 14:19267193-19267215 CCGCTGAGAGGCGGCCTGGGCGC No data
Right 1114088864 14:19267233-19267255 GAGGTTCGGAACGGACCCCCGGG No data
1114088857_1114088864 3 Left 1114088857 14:19267207-19267229 CCTGGGCGCCGGCACCACTAGGA No data
Right 1114088864 14:19267233-19267255 GAGGTTCGGAACGGACCCCCGGG No data
1114088859_1114088864 -5 Left 1114088859 14:19267215-19267237 CCGGCACCACTAGGAGTCGAGGT No data
Right 1114088864 14:19267233-19267255 GAGGTTCGGAACGGACCCCCGGG No data
1114088852_1114088864 20 Left 1114088852 14:19267190-19267212 CCGCCGCTGAGAGGCGGCCTGGG No data
Right 1114088864 14:19267233-19267255 GAGGTTCGGAACGGACCCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114088864 Original CRISPR GAGGTTCGGAACGGACCCCC GGG Intergenic
No off target data available for this crispr