ID: 1114088870

View in Genome Browser
Species Human (GRCh38)
Location 14:19267256-19267278
Sequence GCTGCAACCGCCAGCGCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114088857_1114088870 26 Left 1114088857 14:19267207-19267229 CCTGGGCGCCGGCACCACTAGGA No data
Right 1114088870 14:19267256-19267278 GCTGCAACCGCCAGCGCCTCAGG No data
1114088861_1114088870 12 Left 1114088861 14:19267221-19267243 CCACTAGGAGTCGAGGTTCGGAA No data
Right 1114088870 14:19267256-19267278 GCTGCAACCGCCAGCGCCTCAGG No data
1114088859_1114088870 18 Left 1114088859 14:19267215-19267237 CCGGCACCACTAGGAGTCGAGGT No data
Right 1114088870 14:19267256-19267278 GCTGCAACCGCCAGCGCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114088870 Original CRISPR GCTGCAACCGCCAGCGCCTC AGG Intergenic
No off target data available for this crispr