ID: 1114088871

View in Genome Browser
Species Human (GRCh38)
Location 14:19267257-19267279
Sequence CTGCAACCGCCAGCGCCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114088857_1114088871 27 Left 1114088857 14:19267207-19267229 CCTGGGCGCCGGCACCACTAGGA No data
Right 1114088871 14:19267257-19267279 CTGCAACCGCCAGCGCCTCAGGG No data
1114088859_1114088871 19 Left 1114088859 14:19267215-19267237 CCGGCACCACTAGGAGTCGAGGT No data
Right 1114088871 14:19267257-19267279 CTGCAACCGCCAGCGCCTCAGGG No data
1114088861_1114088871 13 Left 1114088861 14:19267221-19267243 CCACTAGGAGTCGAGGTTCGGAA No data
Right 1114088871 14:19267257-19267279 CTGCAACCGCCAGCGCCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114088871 Original CRISPR CTGCAACCGCCAGCGCCTCA GGG Intergenic
No off target data available for this crispr