ID: 1114090551

View in Genome Browser
Species Human (GRCh38)
Location 14:19284723-19284745
Sequence GCAATCGTGCATCTTCTCAT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114090541_1114090551 11 Left 1114090541 14:19284689-19284711 CCCTTCCCCCATTGCAGCCCTCA No data
Right 1114090551 14:19284723-19284745 GCAATCGTGCATCTTCTCATCGG No data
1114090545_1114090551 4 Left 1114090545 14:19284696-19284718 CCCATTGCAGCCCTCAGTACCTG No data
Right 1114090551 14:19284723-19284745 GCAATCGTGCATCTTCTCATCGG No data
1114090549_1114090551 -7 Left 1114090549 14:19284707-19284729 CCTCAGTACCTGAATGGCAATCG No data
Right 1114090551 14:19284723-19284745 GCAATCGTGCATCTTCTCATCGG No data
1114090548_1114090551 -6 Left 1114090548 14:19284706-19284728 CCCTCAGTACCTGAATGGCAATC No data
Right 1114090551 14:19284723-19284745 GCAATCGTGCATCTTCTCATCGG No data
1114090543_1114090551 6 Left 1114090543 14:19284694-19284716 CCCCCATTGCAGCCCTCAGTACC No data
Right 1114090551 14:19284723-19284745 GCAATCGTGCATCTTCTCATCGG No data
1114090544_1114090551 5 Left 1114090544 14:19284695-19284717 CCCCATTGCAGCCCTCAGTACCT No data
Right 1114090551 14:19284723-19284745 GCAATCGTGCATCTTCTCATCGG No data
1114090546_1114090551 3 Left 1114090546 14:19284697-19284719 CCATTGCAGCCCTCAGTACCTGA No data
Right 1114090551 14:19284723-19284745 GCAATCGTGCATCTTCTCATCGG No data
1114090540_1114090551 14 Left 1114090540 14:19284686-19284708 CCACCCTTCCCCCATTGCAGCCC No data
Right 1114090551 14:19284723-19284745 GCAATCGTGCATCTTCTCATCGG No data
1114090542_1114090551 10 Left 1114090542 14:19284690-19284712 CCTTCCCCCATTGCAGCCCTCAG No data
Right 1114090551 14:19284723-19284745 GCAATCGTGCATCTTCTCATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114090551 Original CRISPR GCAATCGTGCATCTTCTCAT CGG Intergenic
No off target data available for this crispr