ID: 1114091296

View in Genome Browser
Species Human (GRCh38)
Location 14:19293487-19293509
Sequence CTAAGACTCTCTGAAGGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 1, 2: 4, 3: 30, 4: 221}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114091291_1114091296 16 Left 1114091291 14:19293448-19293470 CCAACAACATCAAGGCAAGACCC No data
Right 1114091296 14:19293487-19293509 CTAAGACTCTCTGAAGGCTCAGG 0: 1
1: 1
2: 4
3: 30
4: 221
1114091293_1114091296 -5 Left 1114091293 14:19293469-19293491 CCTTCACCAGCAAAAAGACTAAG No data
Right 1114091296 14:19293487-19293509 CTAAGACTCTCTGAAGGCTCAGG 0: 1
1: 1
2: 4
3: 30
4: 221
1114091292_1114091296 -4 Left 1114091292 14:19293468-19293490 CCCTTCACCAGCAAAAAGACTAA No data
Right 1114091296 14:19293487-19293509 CTAAGACTCTCTGAAGGCTCAGG 0: 1
1: 1
2: 4
3: 30
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114091296 Original CRISPR CTAAGACTCTCTGAAGGCTC AGG Intergenic
900322037 1:2089538-2089560 AGAAGACTCTGAGAAGGCTCTGG - Intronic
900422371 1:2561143-2561165 CCAAGAAGCTCTGAAGTCTCAGG - Intronic
900932272 1:5744929-5744951 CTGTGACGCTCTGAAGACTCAGG + Intergenic
903040952 1:20529987-20530009 AGAAGATTCTCTGAGGGCTCAGG + Intergenic
905545745 1:38798576-38798598 TGACGACTCGCTGAAGGCTCAGG - Intergenic
906874129 1:49517294-49517316 CTAAAACTCTTTGAAGGTTGAGG + Intronic
907002242 1:50873099-50873121 TTAATACTTGCTGAAGGCTCAGG + Intronic
907493988 1:54829983-54830005 CTAAATCCTTCTGAAGGCTCTGG + Intronic
907582851 1:55587566-55587588 GGAAGACTCTCTGAAGACACAGG - Intergenic
909838857 1:80292415-80292437 CTAAGACTCCCAGATGACTCTGG + Intergenic
912020671 1:105106110-105106132 ATAAGTCTCTCTGAAAACTCGGG + Intergenic
914436291 1:147662992-147663014 TCATGACTCACTGAAGGCTCAGG + Intronic
915322057 1:155061606-155061628 CTCAGAGTGTCTGAAGGCTGAGG - Intronic
917853040 1:179081765-179081787 CTAGGACTTTCGGACGGCTCTGG - Exonic
920020767 1:202954926-202954948 CATAGACTCTCTAAAGGCCCAGG - Intronic
921192295 1:212721522-212721544 CTCAACCTCTCAGAAGGCTCAGG - Intergenic
922404336 1:225297016-225297038 CTAACACTCTCTGAAGACTTGGG + Intronic
923718138 1:236444059-236444081 CTACAACTTGCTGAAGGCTCAGG + Intronic
1063439040 10:6057131-6057153 TTATGACTCTCTTAAGGATCAGG + Intronic
1064301058 10:14123286-14123308 CCAAGACTCCCTGCAGGCACAGG + Intronic
1064552515 10:16519246-16519268 CTAAGAATCTCTGAATGTCCAGG + Intronic
1065358671 10:24868277-24868299 CTAAGACTATCTGAATCCTAAGG + Intronic
1068197631 10:53738566-53738588 TTAAGACTTTCTGAAGACTCAGG - Intergenic
1069937953 10:71931808-71931830 ATATGACTCACTGAAGACTCAGG - Intergenic
1071439012 10:85673591-85673613 TTACAACTCACTGAAGGCTCAGG + Intronic
1071598760 10:86945918-86945940 CTCAGCCTCTCTGCTGGCTCGGG - Intronic
1072621432 10:97081959-97081981 ATCAGACTCTCTGTAGGCTTTGG - Intronic
1074271105 10:111954434-111954456 CTGAGAGTCTGTGAAGGCTTTGG - Intergenic
1075034408 10:119051917-119051939 TTATGACTCATTGAAGGCTCAGG - Intronic
1076492390 10:130871349-130871371 GTAATATTTTCTGAAGGCTCTGG + Intergenic
1077176997 11:1195545-1195567 CTGAGGCTCTCTGCTGGCTCAGG + Intronic
1078325905 11:10380613-10380635 CTTAGCCTCACTGAAGACTCTGG + Intronic
1079749431 11:24178783-24178805 AGAAGACTCTCTGCAGGCACTGG + Intergenic
1081161357 11:39753931-39753953 TTACAACTCACTGAAGGCTCAGG - Intergenic
1082922855 11:58514550-58514572 TTACAACTCACTGAAGGCTCAGG - Intergenic
1085711230 11:78830646-78830668 CTACGACTCTCCGAAGGCTTGGG + Intronic
1085858273 11:80200749-80200771 TTATGACTCGCTGAAGGCTCAGG + Intergenic
1086582328 11:88413451-88413473 CTATGAATCTCTGGAGGATCTGG - Intergenic
1087160809 11:94946445-94946467 CTAGGACTCTGTGAAAGGTCAGG + Intergenic
1092926599 12:13277854-13277876 CTTAGGCTCACTGAAGGCACTGG + Intergenic
1095605119 12:44058228-44058250 CTAAGAATCTCAGCAGCCTCAGG + Intronic
1096856099 12:54484413-54484435 CTAAGAATCTTTAAAGGCTTAGG + Intergenic
1103896525 12:124277280-124277302 CTAAGTCCCTCTGTGGGCTCCGG - Intronic
1104576900 12:129974318-129974340 TTCAGACTCTCTGAACTCTCAGG - Intergenic
1107111081 13:36698816-36698838 CTCAGACTCTCTGAAGTCTTAGG - Intergenic
1107526353 13:41235689-41235711 TTGTGCCTCTCTGAAGGCTCTGG - Intronic
1107708251 13:43128073-43128095 CTAAGCCCCTCTGAGGGCTGTGG + Intergenic
1108330997 13:49383884-49383906 TTAGGACTCACTGAAGGGTCAGG - Intronic
1112914082 13:104524101-104524123 CACACTCTCTCTGAAGGCTCTGG + Intergenic
1113269803 13:108661322-108661344 CTAGGTCTCTCTCAAGGCTGGGG + Intronic
1114070967 14:19106518-19106540 CTAAGACTCCCTGAAGGCGCAGG - Intergenic
1114091296 14:19293487-19293509 CTAAGACTCTCTGAAGGCTCAGG + Intergenic
1114569058 14:23653191-23653213 CTGAGCCTCTCTGAAAGGTCTGG - Intergenic
1117084963 14:52190621-52190643 TTATGACTCACTGAAGGCTCAGG + Intergenic
1118619130 14:67598823-67598845 CTCAGCCACTCGGAAGGCTCAGG - Intronic
1119265120 14:73259806-73259828 CTGAGACTCCGAGAAGGCTCTGG + Intronic
1119457749 14:74770688-74770710 ATAAGGCTCACTGAAAGCTCAGG + Intronic
1119727537 14:76930885-76930907 CTCTCTCTCTCTGAAGGCTCTGG + Intergenic
1120224455 14:81774911-81774933 CTAAGACTCTCAGAGGTTTCAGG - Intergenic
1121188773 14:92003984-92004006 CTAAGACACTCTGCAGACTGGGG + Exonic
1122004499 14:98690845-98690867 CCAGAACTCTCTGAAAGCTCAGG + Intergenic
1124036733 15:26060120-26060142 TTATGACTCACTGAAGGCTCGGG + Intergenic
1124247553 15:28084094-28084116 CCACGACTCTCAGAAGGGTCTGG - Intronic
1124547139 15:30640393-30640415 CTATTACTCTCTGAAGGCTCTGG - Intronic
1124780738 15:32630355-32630377 CTATTACTCTCTGAAGGCTCTGG - Intronic
1125822516 15:42644558-42644580 TTATGACTCACTGAAGGCTCAGG - Intronic
1127075561 15:55322056-55322078 CTCAGACTTTCTGGAGGCTGAGG + Intronic
1128724185 15:69975616-69975638 CCAGGAGTCTCTGAAGGCTGGGG - Intergenic
1130839651 15:87686005-87686027 CCAAAGCTCTCTGAAGGGTCTGG + Intergenic
1136032592 16:27514406-27514428 CAAGAACTATCTGAAGGCTCGGG + Intronic
1137321758 16:47391022-47391044 CTAAGATTCTCTACAGGCTCGGG - Intronic
1139036228 16:62949928-62949950 CTCTCACTCTCTGGAGGCTCTGG + Intergenic
1140995349 16:80253640-80253662 CTGAGCCTCTGTGGAGGCTCTGG - Intergenic
1143179262 17:4974047-4974069 CTAAGGCTCAGAGAAGGCTCTGG - Intronic
1143753268 17:9047101-9047123 TTATGACTTGCTGAAGGCTCAGG - Intronic
1144494511 17:15737841-15737863 CTGAGACCCTCTGAAGGAACTGG - Intronic
1144500648 17:15784083-15784105 ATATGACTCTTTGAAGGATCTGG - Intergenic
1144561785 17:16326621-16326643 CAAAAGCTCTCTGAAAGCTCTGG + Intronic
1144783180 17:17817899-17817921 CACAGAATCTCTGAAGGATCTGG - Exonic
1144905752 17:18638835-18638857 CTGAGACCCTCTGAAGGAACTGG + Intronic
1148075555 17:44933468-44933490 CAAAGACTCTCTGAAGACAGAGG + Intronic
1148803584 17:50250892-50250914 TTATGACTTGCTGAAGGCTCAGG - Intergenic
1149903327 17:60502176-60502198 CTCAGACTCTCTGAGTGCTGGGG + Intronic
1151783126 17:76260854-76260876 CACACACTCCCTGAAGGCTCGGG - Intergenic
1152267485 17:79304797-79304819 CTAAGATTCTCGGAAGGTGCTGG + Intronic
1152813345 17:82392582-82392604 CGCAGACCCTCTGAAGGCTGTGG - Intronic
1155742832 18:29311376-29311398 CTAAATCTCTCTGAAATCTCTGG + Intergenic
1160217959 18:76950030-76950052 TTACAACTCACTGAAGGCTCAGG - Intronic
1160884767 19:1340656-1340678 CTAAGATACTCTGGAGGCTGAGG + Intergenic
1164846126 19:31433995-31434017 CTAAGACTCGTCCAAGGCTCAGG + Intergenic
1165232285 19:34394642-34394664 CTAAGCCTCTCGGGGGGCTCTGG - Intronic
1165599108 19:37037656-37037678 CGGAGACTCTCAGAAGGTTCTGG + Intronic
1167596942 19:50432835-50432857 CTGAGACTCCCAGAAGGCTCCGG - Intergenic
1167780291 19:51594564-51594586 CTACGACTCCCGGAAGGCTTTGG - Intergenic
1168323344 19:55523558-55523580 CTATGACTTGCTGAAGACTCCGG - Intergenic
925168377 2:1734338-1734360 AGAAAACTCTCTGAAGGCTCAGG - Intronic
925745951 2:7043769-7043791 CTACCCCTCACTGAAGGCTCCGG - Exonic
925778524 2:7357732-7357754 CTAAGGCTATGTGAAGGCCCTGG - Intergenic
927298882 2:21487410-21487432 TTACGACTTACTGAAGGCTCTGG - Intergenic
928124348 2:28605517-28605539 CTAAGACTCTCTGCGGGACCAGG + Intronic
928298030 2:30102305-30102327 CTAAGTCCCCCTGAAGGCTCTGG - Intergenic
929237680 2:39624015-39624037 CCAAGACTCTCAGGAGTCTCAGG + Intergenic
930559351 2:52941110-52941132 TTATGACTCACTGAAGGCACTGG + Intergenic
930580750 2:53208941-53208963 CTGGGACTATCTGAAGTCTCTGG - Intergenic
930668237 2:54120893-54120915 GTAACACTTTCTGGAGGCTCAGG - Intronic
931561960 2:63571568-63571590 CCACAACTCTCTGAAGGCACTGG - Intronic
932460031 2:71876086-71876108 CTCAGACTCCCTGCAGGTTCTGG - Intergenic
933873733 2:86597158-86597180 TTATGACTTGCTGAAGGCTCAGG + Intronic
933896968 2:86820465-86820487 TTATGACTCACTGAAAGCTCAGG + Intronic
935192439 2:100789633-100789655 CTAGAACTCTCAGATGGCTCTGG - Intergenic
937637677 2:124174957-124174979 TTATGACTTGCTGAAGGCTCAGG + Intronic
939867988 2:147495976-147495998 TCATGACTCACTGAAGGCTCAGG + Intergenic
942469926 2:176249721-176249743 CTAGGTCTCTATGAAGGCTGGGG + Intergenic
942623085 2:177869308-177869330 ATATTCCTCTCTGAAGGCTCTGG + Intronic
946872642 2:224098224-224098246 GTATGACTTTCTGGAGGCTCGGG + Intergenic
1168862758 20:1057901-1057923 CCCAGATACTCTGAAGGCTCTGG - Intergenic
1169654023 20:7902404-7902426 CTACAACTCGCTGAAGACTCAGG + Intronic
1169945070 20:10979292-10979314 CTAAAACTCTCTGAAGTTTCAGG - Intergenic
1169996257 20:11560614-11560636 CTCAGCTACTCTGAAGGCTCAGG - Intergenic
1172039548 20:32034468-32034490 CTAAGGCTCCCTGTAGCCTCAGG - Intergenic
1172935580 20:38617634-38617656 CTAAGCCTCTGTGAGGGCTCCGG + Intronic
1173132440 20:40407463-40407485 CTAAACCTCTCTGAAGCATCAGG + Intergenic
1177096048 21:16834620-16834642 CTATCACTCTCTGGAGACTCTGG - Intergenic
1177167099 21:17614625-17614647 CTCAGATACTCTGAAGGCTGGGG + Intergenic
1178142807 21:29702825-29702847 CTTATTTTCTCTGAAGGCTCTGG - Intronic
1180489433 22:15828984-15829006 CTAAGACTCCCTGAAGGCTCAGG - Intergenic
1182662938 22:31937768-31937790 CTCAGACTCTCTGAAGGTCAGGG + Intronic
1183532663 22:38370585-38370607 CTATGACTTGCTAAAGGCTCAGG - Intronic
1184143255 22:42592138-42592160 CTCACACACTCTGAAGGCCCTGG + Intronic
1184636017 22:45832229-45832251 CTAAGAATCCCTGAAGGAGCTGG + Intronic
950236228 3:11322981-11323003 CCAAGATACTCTGAAGGCTGAGG + Intronic
951667244 3:25140871-25140893 TTATGACTCACTGAAGGCTCAGG + Intergenic
954519362 3:51210341-51210363 CTGAGGCTCTCTGAAGTCTGTGG - Intronic
955614288 3:60789575-60789597 CTAAGATTCTCTGGATTCTCAGG + Intronic
955814512 3:62827609-62827631 CTAAGACTCTATGAATAATCAGG + Intronic
956063396 3:65371441-65371463 TTACAACTCACTGAAGGCTCAGG - Intronic
957280199 3:78141448-78141470 CTATGACTCTCTGACTGCCCAGG - Intergenic
958096482 3:88952025-88952047 CTATGACTTGCTGAAGGCTCAGG + Intergenic
958263039 3:91404434-91404456 CTCAGACTCTCTGAAGGAAGCGG - Intergenic
958906268 3:99945353-99945375 CTCAGACTCTCTGAGGTCTGTGG + Intronic
959082487 3:101816806-101816828 CTAGAACTATCTCAAGGCTCAGG + Exonic
959220909 3:103518239-103518261 TTAAAACTCCCTGAAGGATCTGG - Intergenic
959908541 3:111737163-111737185 CTAAGATGTTCTGAAGGGTCCGG + Intronic
960863140 3:122172403-122172425 AAACGACTCACTGAAGGCTCAGG - Intergenic
961047531 3:123719924-123719946 CTGAGACACTCAGGAGGCTCGGG - Intronic
961270429 3:125683709-125683731 CTGAGACACTCGGGAGGCTCGGG + Intergenic
961634682 3:128325542-128325564 CTAAGAGTCTTTGCAGCCTCAGG + Intronic
961655714 3:128440554-128440576 CTAAAACTCAGGGAAGGCTCTGG - Intergenic
963293040 3:143512963-143512985 TTATGATTCACTGAAGGCTCAGG - Intronic
964126890 3:153243164-153243186 TTGCGACTCACTGAAGGCTCAGG + Intergenic
964759783 3:160123908-160123930 TAAAAACTCTCTGAATGCTCGGG - Intergenic
966093964 3:176175433-176175455 CTTAGACTCTTTGAAAGCTGAGG + Intergenic
966269561 3:178088539-178088561 CCAAGACTTTGTGAAGGCTAAGG + Intergenic
967548449 3:190760701-190760723 CTGATTCTCTCTGAAGGTTCTGG + Intergenic
967802877 3:193683696-193683718 TTATGACTTGCTGAAGGCTCAGG + Intronic
968635463 4:1676211-1676233 CCATGCCCCTCTGAAGGCTCTGG + Intronic
972837512 4:42891032-42891054 TTACGACTTTCTGAAGGCTAAGG + Intergenic
974985681 4:69023514-69023536 CACAGACTCTCTGAAGGAACTGG - Intronic
975120571 4:70723908-70723930 CTAAAACTTTCTCAAGGCTAAGG - Intronic
975124776 4:70769466-70769488 TTACAACTCACTGAAGGCTCAGG - Intronic
975545353 4:75555238-75555260 CTGAGACTTGCTGAAGCCTCAGG - Intergenic
975879138 4:78881683-78881705 CTAATAAACTCTGAAGGTTCTGG - Intronic
976938632 4:90671903-90671925 CTAAGACTCTCTGATGGAGATGG - Intronic
977981124 4:103323428-103323450 TTATGACTCATTGAAGGCTCAGG - Intergenic
980106190 4:128590939-128590961 CCTGGACTCTCTGAGGGCTCAGG + Intergenic
981036942 4:140180594-140180616 TTATGACTCGCTGAAGGCACAGG + Intergenic
981311710 4:143304017-143304039 TTAAGACTTGCTGAAGGCTCAGG + Intergenic
981710722 4:147706588-147706610 CTGCGACTTGCTGAAGGCTCAGG - Intergenic
983464609 4:168071452-168071474 TTATGACTCACTGAAGGCTCAGG - Intergenic
985316761 4:188666188-188666210 CTATGACTCTCCGAAGCTTCAGG + Intergenic
985328536 4:188799804-188799826 TTATGACTCTCTGAAGGCTTAGG + Intergenic
985338044 4:188916934-188916956 CTATGACTCCCTGAAGTCTCAGG - Intergenic
987888732 5:23847355-23847377 TTCAGACTCGCTGAAGGCTGAGG + Intergenic
988463844 5:31468364-31468386 CTTAACCTCTCTGAAGGCACAGG + Intronic
988757367 5:34271089-34271111 CTTAGATTCTCTGAATGCTGAGG + Intergenic
988863874 5:35313630-35313652 CTAACACTCTCTGGAGGGGCAGG + Intergenic
988910611 5:35837901-35837923 CTCAGACACTCTGGAGGCTGAGG - Intergenic
990451980 5:55942701-55942723 ATATGACTCTTTGAAGGATCTGG + Exonic
991210370 5:64097516-64097538 CTCAGTCTCTCTGAAGTCCCAGG + Intergenic
991984386 5:72268900-72268922 CTAAGTATCTCTGAAGGCAGGGG + Intronic
993325113 5:86524687-86524709 CTAAGATTCCCTGAGGGCTATGG + Intergenic
993489436 5:88528273-88528295 CTTAGACACTCAGAAGGCTGAGG - Intergenic
994255673 5:97592773-97592795 TTATGACTCACTGAAGGCTCAGG - Intergenic
994698021 5:103097414-103097436 TGAAGACTATCTGAAGTCTCAGG + Exonic
997824536 5:137094597-137094619 TCATGACTTTCTGAAGGCTCAGG - Intronic
1000324935 5:160165082-160165104 CTCAGACACTCTTAAGGCTTGGG - Intergenic
1000454309 5:161430200-161430222 CTAAAACTCACTGAAGGTTAAGG + Intronic
1000549726 5:162645875-162645897 ATGTGACTCGCTGAAGGCTCAGG - Intergenic
1000690185 5:164307948-164307970 CTAAGAATCTGTGAAGGGCCTGG - Intergenic
1001117883 5:168954990-168955012 CAAAGACATTCTGAAGTCTCTGG - Intronic
1001588443 5:172849364-172849386 CTAAGAATCACTGAAGACACTGG - Intronic
1001987181 5:176084524-176084546 CTAGGACTCTCTGGTGACTCAGG + Intronic
1002229687 5:177753623-177753645 CTAGGACTCTCTGGTGACTCAGG - Intronic
1002265658 5:178030154-178030176 CTAGGACTCTCTGGTGACTCAGG + Intronic
1004439373 6:15633832-15633854 TTATGATTCACTGAAGGCTCAGG + Intronic
1004453278 6:15767364-15767386 CATACTCTCTCTGAAGGCTCTGG - Intergenic
1004917707 6:20347250-20347272 CTCACTCTCTCTGAAGGCTCTGG - Intergenic
1004926496 6:20420691-20420713 AGATGACTCGCTGAAGGCTCAGG - Intronic
1008992368 6:57618454-57618476 CTCAGACTCTCTGAAGGAAGCGG + Intronic
1009180992 6:60517566-60517588 CTCAGACTCTCTGAAGGAAGCGG + Intergenic
1010288966 6:74113837-74113859 TGATGACTCACTGAAGGCTCAGG + Intergenic
1010865402 6:80970570-80970592 CTAAAACTCTCTGAAGCCTCTGG - Intergenic
1012472194 6:99584591-99584613 TTATGACCCACTGAAGGCTCAGG - Intergenic
1013809813 6:114032044-114032066 CTCAGCCTCTCTGGAGGCTGAGG - Intergenic
1016572371 6:145529475-145529497 TTATGACTCTCTGAAGGTTCAGG + Intronic
1019767661 7:2863577-2863599 CTCACACTCTCGGGAGGCTCAGG - Intergenic
1019869502 7:3746281-3746303 AAAAGACTTGCTGAAGGCTCAGG - Intronic
1021774337 7:24037607-24037629 CTGATCTTCTCTGAAGGCTCTGG + Intergenic
1022006431 7:26269946-26269968 TTAAGACTCACTGAAGTCTCAGG - Intergenic
1024083463 7:45874662-45874684 CTAGTGCTCTCTGAAGCCTCAGG - Intergenic
1024932368 7:54677349-54677371 TTATGACTCGCTGAAGGCTCAGG + Intergenic
1026247623 7:68635240-68635262 ATCAGACTCTCTGAAAACTCAGG + Intergenic
1026537571 7:71252651-71252673 CTAACACTCTCTAATGGGTCTGG - Intronic
1027729169 7:81847955-81847977 CGAATAGTCCCTGAAGGCTCAGG - Intergenic
1027944686 7:84729837-84729859 TTATGACTCACTGAAGGCTCAGG - Intergenic
1029050075 7:97676795-97676817 TTATGACTCGCTGAAGGTTCAGG + Intergenic
1030537150 7:110782730-110782752 CAAAGAGTTTCTGAAGGATCTGG - Intronic
1031862330 7:126994568-126994590 CTAAGATTCACTTAAGGCCCAGG - Intronic
1032306703 7:130740458-130740480 TTAAGACTCTCTGACATCTCTGG - Intergenic
1033157233 7:138967592-138967614 CTAAGACTCTCTTCAGGCCCAGG + Intronic
1034125348 7:148666665-148666687 CTAAGACTTTTTCAAAGCTCTGG - Intergenic
1034308917 7:150070188-150070210 GTAAGCCTGTCTGGAGGCTCTGG + Intergenic
1034336984 7:150330152-150330174 CTAAGGCTCTGTGGAGGCCCAGG + Exonic
1034530532 7:151693595-151693617 GTAAAACTTTCTGAAGGCTGTGG + Intronic
1034797932 7:154030454-154030476 GTAAGCCTGTCTGGAGGCTCTGG - Intronic
1037043527 8:14267630-14267652 CAAAAACTCTCTGAAGCATCAGG - Intronic
1038493915 8:27988497-27988519 GTAAGACGCTATGATGGCTCCGG + Intronic
1038938066 8:32274661-32274683 GTAAAACTGTCTGAAGACTCAGG - Intronic
1039465234 8:37780634-37780656 CTCACAGTCTCTGAAGGCGCTGG + Intergenic
1041540157 8:58975658-58975680 TTATGACTTGCTGAAGGCTCAGG - Intronic
1044259396 8:90099888-90099910 TGATGACTCACTGAAGGCTCAGG - Intergenic
1045038472 8:98196667-98196689 CAAAAACTCTATGAAGGCTTTGG - Intronic
1047409176 8:124610357-124610379 CTAACAATCTCTGAAGCTTCAGG + Intronic
1047762624 8:127965458-127965480 CTAAGGCTTGCTGTAGGCTCTGG + Intergenic
1048570359 8:135649227-135649249 GTAAGACTCTCTGGAAGATCAGG - Intronic
1048770042 8:137885534-137885556 CTAAATCTCTCTGAAGCCTGAGG + Intergenic
1052186778 9:25606635-25606657 TTATGACTCTCTGAAGGTTCAGG + Intergenic
1053217503 9:36284387-36284409 AGATGACTCACTGAAGGCTCAGG - Intronic
1056223970 9:84477377-84477399 CTCAGACTCCCTGAAAGCTAGGG - Intergenic
1056979490 9:91295641-91295663 TTATGATTCTTTGAAGGCTCAGG + Intronic
1060424166 9:123491029-123491051 CTAAGACTATCTGAAGGACTGGG + Intronic
1062658115 9:137614555-137614577 CCAGGTCTCTCTGAAGGCGCCGG + Exonic
1185734140 X:2484779-2484801 CTGAGACTCGCAGAAGGCGCAGG + Intronic
1186355870 X:8789102-8789124 ATCAGACACTCTGAAGGCTGAGG + Intergenic
1187982747 X:24776146-24776168 CTCAGACTTTCTGAAGACTATGG - Intronic
1190369730 X:49729155-49729177 CTCAGATACTCTGAAGGCTGAGG - Intergenic
1195279638 X:103318523-103318545 CTAAAACTCTCTGAAGGAGAGGG + Intergenic
1196529129 X:116762984-116763006 TTAAGATTCTCTCAAGGCTCAGG - Intergenic
1197047038 X:122010136-122010158 CAAAGACTCTCTAACTGCTCTGG - Intergenic
1197628330 X:128828894-128828916 TTACAACTCGCTGAAGGCTCAGG + Intergenic
1198604606 X:138322796-138322818 CACAGACTCTTTGAAGGATCTGG - Intergenic
1200013941 X:153144479-153144501 GTATGACTCACTGACGGCTCAGG + Intergenic
1200025659 X:153255474-153255496 GTATGACTCACTGACGGCTCAGG - Intergenic
1200260033 X:154609763-154609785 CTCAGACTCATTGTAGGCTCGGG + Intergenic
1200389018 X:155924619-155924641 TTAAGGCTCACTGAAGGCTCAGG - Intronic
1200429779 Y:3065618-3065640 CAAAAACTCTCTCAAGGCTTAGG + Intergenic
1201497241 Y:14601594-14601616 CCAAGACGCTCTGACGCCTCAGG - Intronic