ID: 1114092040

View in Genome Browser
Species Human (GRCh38)
Location 14:19300481-19300503
Sequence CCTGGGGACCCAAGGTTGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114092040_1114092058 24 Left 1114092040 14:19300481-19300503 CCGCCCAACCTTGGGTCCCCAGG No data
Right 1114092058 14:19300528-19300550 AGCGCTGCCGCCAGAGCTCCAGG No data
1114092040_1114092045 -9 Left 1114092040 14:19300481-19300503 CCGCCCAACCTTGGGTCCCCAGG No data
Right 1114092045 14:19300495-19300517 GTCCCCAGGCCCAGCCTCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114092040 Original CRISPR CCTGGGGACCCAAGGTTGGG CGG (reversed) Intergenic