ID: 1114092042

View in Genome Browser
Species Human (GRCh38)
Location 14:19300484-19300506
Sequence GGGCCTGGGGACCCAAGGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114092042_1114092058 21 Left 1114092042 14:19300484-19300506 CCCAACCTTGGGTCCCCAGGCCC No data
Right 1114092058 14:19300528-19300550 AGCGCTGCCGCCAGAGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114092042 Original CRISPR GGGCCTGGGGACCCAAGGTT GGG (reversed) Intergenic