ID: 1114092044

View in Genome Browser
Species Human (GRCh38)
Location 14:19300489-19300511
Sequence AGGCTGGGCCTGGGGACCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114092044_1114092058 16 Left 1114092044 14:19300489-19300511 CCTTGGGTCCCCAGGCCCAGCCT No data
Right 1114092058 14:19300528-19300550 AGCGCTGCCGCCAGAGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114092044 Original CRISPR AGGCTGGGCCTGGGGACCCA AGG (reversed) Intergenic