ID: 1114092045

View in Genome Browser
Species Human (GRCh38)
Location 14:19300495-19300517
Sequence GTCCCCAGGCCCAGCCTCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114092033_1114092045 5 Left 1114092033 14:19300467-19300489 CCACCTCCTGCGCCCCGCCCAAC No data
Right 1114092045 14:19300495-19300517 GTCCCCAGGCCCAGCCTCCGAGG No data
1114092036_1114092045 -1 Left 1114092036 14:19300473-19300495 CCTGCGCCCCGCCCAACCTTGGG No data
Right 1114092045 14:19300495-19300517 GTCCCCAGGCCCAGCCTCCGAGG No data
1114092034_1114092045 2 Left 1114092034 14:19300470-19300492 CCTCCTGCGCCCCGCCCAACCTT No data
Right 1114092045 14:19300495-19300517 GTCCCCAGGCCCAGCCTCCGAGG No data
1114092032_1114092045 6 Left 1114092032 14:19300466-19300488 CCCACCTCCTGCGCCCCGCCCAA No data
Right 1114092045 14:19300495-19300517 GTCCCCAGGCCCAGCCTCCGAGG No data
1114092031_1114092045 12 Left 1114092031 14:19300460-19300482 CCTGAGCCCACCTCCTGCGCCCC No data
Right 1114092045 14:19300495-19300517 GTCCCCAGGCCCAGCCTCCGAGG No data
1114092030_1114092045 13 Left 1114092030 14:19300459-19300481 CCCTGAGCCCACCTCCTGCGCCC No data
Right 1114092045 14:19300495-19300517 GTCCCCAGGCCCAGCCTCCGAGG No data
1114092040_1114092045 -9 Left 1114092040 14:19300481-19300503 CCGCCCAACCTTGGGTCCCCAGG No data
Right 1114092045 14:19300495-19300517 GTCCCCAGGCCCAGCCTCCGAGG No data
1114092038_1114092045 -7 Left 1114092038 14:19300479-19300501 CCCCGCCCAACCTTGGGTCCCCA No data
Right 1114092045 14:19300495-19300517 GTCCCCAGGCCCAGCCTCCGAGG No data
1114092039_1114092045 -8 Left 1114092039 14:19300480-19300502 CCCGCCCAACCTTGGGTCCCCAG No data
Right 1114092045 14:19300495-19300517 GTCCCCAGGCCCAGCCTCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114092045 Original CRISPR GTCCCCAGGCCCAGCCTCCG AGG Intergenic