ID: 1114092046 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14:19300497-19300519 |
| Sequence | GGCCTCGGAGGCTGGGCCTG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1114092046_1114092061 | 23 | Left | 1114092046 | 14:19300497-19300519 | CCCCAGGCCCAGCCTCCGAGGCC | No data | ||
| Right | 1114092061 | 14:19300543-19300565 | GCTCCAGGCTGCGCTCCCCCAGG | 0: 3 1: 1 2: 4 3: 50 4: 338 |
||||
| 1114092046_1114092063 | 29 | Left | 1114092046 | 14:19300497-19300519 | CCCCAGGCCCAGCCTCCGAGGCC | No data | ||
| Right | 1114092063 | 14:19300549-19300571 | GGCTGCGCTCCCCCAGGCAAAGG | No data | ||||
| 1114092046_1114092058 | 8 | Left | 1114092046 | 14:19300497-19300519 | CCCCAGGCCCAGCCTCCGAGGCC | No data | ||
| Right | 1114092058 | 14:19300528-19300550 | AGCGCTGCCGCCAGAGCTCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1114092046 | Original CRISPR | GGCCTCGGAGGCTGGGCCTG GGG (reversed) | Intergenic | ||