ID: 1114092048

View in Genome Browser
Species Human (GRCh38)
Location 14:19300499-19300521
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114092048_1114092058 6 Left 1114092048 14:19300499-19300521 CCAGGCCCAGCCTCCGAGGCCCC No data
Right 1114092058 14:19300528-19300550 AGCGCTGCCGCCAGAGCTCCAGG No data
1114092048_1114092061 21 Left 1114092048 14:19300499-19300521 CCAGGCCCAGCCTCCGAGGCCCC No data
Right 1114092061 14:19300543-19300565 GCTCCAGGCTGCGCTCCCCCAGG 0: 3
1: 1
2: 4
3: 50
4: 338
1114092048_1114092063 27 Left 1114092048 14:19300499-19300521 CCAGGCCCAGCCTCCGAGGCCCC No data
Right 1114092063 14:19300549-19300571 GGCTGCGCTCCCCCAGGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114092048 Original CRISPR GGGGCCTCGGAGGCTGGGCC TGG (reversed) Intergenic