ID: 1114092049

View in Genome Browser
Species Human (GRCh38)
Location 14:19300504-19300526
Sequence GGAGCGGGGCCTCGGAGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114092049_1114092063 22 Left 1114092049 14:19300504-19300526 CCCAGCCTCCGAGGCCCCGCTCC No data
Right 1114092063 14:19300549-19300571 GGCTGCGCTCCCCCAGGCAAAGG No data
1114092049_1114092058 1 Left 1114092049 14:19300504-19300526 CCCAGCCTCCGAGGCCCCGCTCC No data
Right 1114092058 14:19300528-19300550 AGCGCTGCCGCCAGAGCTCCAGG No data
1114092049_1114092061 16 Left 1114092049 14:19300504-19300526 CCCAGCCTCCGAGGCCCCGCTCC No data
Right 1114092061 14:19300543-19300565 GCTCCAGGCTGCGCTCCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114092049 Original CRISPR GGAGCGGGGCCTCGGAGGCT GGG (reversed) Intergenic