ID: 1114092051

View in Genome Browser
Species Human (GRCh38)
Location 14:19300509-19300531
Sequence CGCTGGGAGCGGGGCCTCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114092051_1114092058 -4 Left 1114092051 14:19300509-19300531 CCTCCGAGGCCCCGCTCCCAGCG No data
Right 1114092058 14:19300528-19300550 AGCGCTGCCGCCAGAGCTCCAGG No data
1114092051_1114092063 17 Left 1114092051 14:19300509-19300531 CCTCCGAGGCCCCGCTCCCAGCG No data
Right 1114092063 14:19300549-19300571 GGCTGCGCTCCCCCAGGCAAAGG No data
1114092051_1114092061 11 Left 1114092051 14:19300509-19300531 CCTCCGAGGCCCCGCTCCCAGCG No data
Right 1114092061 14:19300543-19300565 GCTCCAGGCTGCGCTCCCCCAGG No data
1114092051_1114092065 26 Left 1114092051 14:19300509-19300531 CCTCCGAGGCCCCGCTCCCAGCG No data
Right 1114092065 14:19300558-19300580 CCCCCAGGCAAAGGCGCCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114092051 Original CRISPR CGCTGGGAGCGGGGCCTCGG AGG (reversed) Intergenic