ID: 1114092055

View in Genome Browser
Species Human (GRCh38)
Location 14:19300520-19300542
Sequence TCTGGCGGCAGCGCTGGGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114092055_1114092063 6 Left 1114092055 14:19300520-19300542 CCGCTCCCAGCGCTGCCGCCAGA No data
Right 1114092063 14:19300549-19300571 GGCTGCGCTCCCCCAGGCAAAGG No data
1114092055_1114092065 15 Left 1114092055 14:19300520-19300542 CCGCTCCCAGCGCTGCCGCCAGA No data
Right 1114092065 14:19300558-19300580 CCCCCAGGCAAAGGCGCCACCGG No data
1114092055_1114092061 0 Left 1114092055 14:19300520-19300542 CCGCTCCCAGCGCTGCCGCCAGA No data
Right 1114092061 14:19300543-19300565 GCTCCAGGCTGCGCTCCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114092055 Original CRISPR TCTGGCGGCAGCGCTGGGAG CGG (reversed) Intergenic