ID: 1114092058

View in Genome Browser
Species Human (GRCh38)
Location 14:19300528-19300550
Sequence AGCGCTGCCGCCAGAGCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114092040_1114092058 24 Left 1114092040 14:19300481-19300503 CCGCCCAACCTTGGGTCCCCAGG No data
Right 1114092058 14:19300528-19300550 AGCGCTGCCGCCAGAGCTCCAGG No data
1114092050_1114092058 0 Left 1114092050 14:19300505-19300527 CCAGCCTCCGAGGCCCCGCTCCC No data
Right 1114092058 14:19300528-19300550 AGCGCTGCCGCCAGAGCTCCAGG No data
1114092042_1114092058 21 Left 1114092042 14:19300484-19300506 CCCAACCTTGGGTCCCCAGGCCC No data
Right 1114092058 14:19300528-19300550 AGCGCTGCCGCCAGAGCTCCAGG No data
1114092052_1114092058 -7 Left 1114092052 14:19300512-19300534 CCGAGGCCCCGCTCCCAGCGCTG No data
Right 1114092058 14:19300528-19300550 AGCGCTGCCGCCAGAGCTCCAGG No data
1114092043_1114092058 20 Left 1114092043 14:19300485-19300507 CCAACCTTGGGTCCCCAGGCCCA No data
Right 1114092058 14:19300528-19300550 AGCGCTGCCGCCAGAGCTCCAGG No data
1114092049_1114092058 1 Left 1114092049 14:19300504-19300526 CCCAGCCTCCGAGGCCCCGCTCC No data
Right 1114092058 14:19300528-19300550 AGCGCTGCCGCCAGAGCTCCAGG No data
1114092038_1114092058 26 Left 1114092038 14:19300479-19300501 CCCCGCCCAACCTTGGGTCCCCA No data
Right 1114092058 14:19300528-19300550 AGCGCTGCCGCCAGAGCTCCAGG No data
1114092048_1114092058 6 Left 1114092048 14:19300499-19300521 CCAGGCCCAGCCTCCGAGGCCCC No data
Right 1114092058 14:19300528-19300550 AGCGCTGCCGCCAGAGCTCCAGG No data
1114092047_1114092058 7 Left 1114092047 14:19300498-19300520 CCCAGGCCCAGCCTCCGAGGCCC No data
Right 1114092058 14:19300528-19300550 AGCGCTGCCGCCAGAGCTCCAGG No data
1114092039_1114092058 25 Left 1114092039 14:19300480-19300502 CCCGCCCAACCTTGGGTCCCCAG No data
Right 1114092058 14:19300528-19300550 AGCGCTGCCGCCAGAGCTCCAGG No data
1114092051_1114092058 -4 Left 1114092051 14:19300509-19300531 CCTCCGAGGCCCCGCTCCCAGCG No data
Right 1114092058 14:19300528-19300550 AGCGCTGCCGCCAGAGCTCCAGG No data
1114092044_1114092058 16 Left 1114092044 14:19300489-19300511 CCTTGGGTCCCCAGGCCCAGCCT No data
Right 1114092058 14:19300528-19300550 AGCGCTGCCGCCAGAGCTCCAGG No data
1114092046_1114092058 8 Left 1114092046 14:19300497-19300519 CCCCAGGCCCAGCCTCCGAGGCC No data
Right 1114092058 14:19300528-19300550 AGCGCTGCCGCCAGAGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114092058 Original CRISPR AGCGCTGCCGCCAGAGCTCC AGG Intergenic