ID: 1114092059

View in Genome Browser
Species Human (GRCh38)
Location 14:19300535-19300557
Sequence AGCGCAGCCTGGAGCTCTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114092059_1114092063 -9 Left 1114092059 14:19300535-19300557 CCGCCAGAGCTCCAGGCTGCGCT No data
Right 1114092063 14:19300549-19300571 GGCTGCGCTCCCCCAGGCAAAGG No data
1114092059_1114092065 0 Left 1114092059 14:19300535-19300557 CCGCCAGAGCTCCAGGCTGCGCT No data
Right 1114092065 14:19300558-19300580 CCCCCAGGCAAAGGCGCCACCGG No data
1114092059_1114092072 28 Left 1114092059 14:19300535-19300557 CCGCCAGAGCTCCAGGCTGCGCT No data
Right 1114092072 14:19300586-19300608 CCAGCGCAGCCTCCTCCTCCAGG 0: 3
1: 2
2: 25
3: 834
4: 16114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114092059 Original CRISPR AGCGCAGCCTGGAGCTCTGG CGG (reversed) Intergenic