ID: 1114092063

View in Genome Browser
Species Human (GRCh38)
Location 14:19300549-19300571
Sequence GGCTGCGCTCCCCCAGGCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114092048_1114092063 27 Left 1114092048 14:19300499-19300521 CCAGGCCCAGCCTCCGAGGCCCC No data
Right 1114092063 14:19300549-19300571 GGCTGCGCTCCCCCAGGCAAAGG No data
1114092054_1114092063 7 Left 1114092054 14:19300519-19300541 CCCGCTCCCAGCGCTGCCGCCAG No data
Right 1114092063 14:19300549-19300571 GGCTGCGCTCCCCCAGGCAAAGG No data
1114092047_1114092063 28 Left 1114092047 14:19300498-19300520 CCCAGGCCCAGCCTCCGAGGCCC No data
Right 1114092063 14:19300549-19300571 GGCTGCGCTCCCCCAGGCAAAGG No data
1114092051_1114092063 17 Left 1114092051 14:19300509-19300531 CCTCCGAGGCCCCGCTCCCAGCG No data
Right 1114092063 14:19300549-19300571 GGCTGCGCTCCCCCAGGCAAAGG No data
1114092059_1114092063 -9 Left 1114092059 14:19300535-19300557 CCGCCAGAGCTCCAGGCTGCGCT No data
Right 1114092063 14:19300549-19300571 GGCTGCGCTCCCCCAGGCAAAGG No data
1114092046_1114092063 29 Left 1114092046 14:19300497-19300519 CCCCAGGCCCAGCCTCCGAGGCC No data
Right 1114092063 14:19300549-19300571 GGCTGCGCTCCCCCAGGCAAAGG No data
1114092049_1114092063 22 Left 1114092049 14:19300504-19300526 CCCAGCCTCCGAGGCCCCGCTCC No data
Right 1114092063 14:19300549-19300571 GGCTGCGCTCCCCCAGGCAAAGG No data
1114092056_1114092063 1 Left 1114092056 14:19300525-19300547 CCCAGCGCTGCCGCCAGAGCTCC No data
Right 1114092063 14:19300549-19300571 GGCTGCGCTCCCCCAGGCAAAGG No data
1114092052_1114092063 14 Left 1114092052 14:19300512-19300534 CCGAGGCCCCGCTCCCAGCGCTG No data
Right 1114092063 14:19300549-19300571 GGCTGCGCTCCCCCAGGCAAAGG No data
1114092053_1114092063 8 Left 1114092053 14:19300518-19300540 CCCCGCTCCCAGCGCTGCCGCCA No data
Right 1114092063 14:19300549-19300571 GGCTGCGCTCCCCCAGGCAAAGG No data
1114092050_1114092063 21 Left 1114092050 14:19300505-19300527 CCAGCCTCCGAGGCCCCGCTCCC No data
Right 1114092063 14:19300549-19300571 GGCTGCGCTCCCCCAGGCAAAGG No data
1114092055_1114092063 6 Left 1114092055 14:19300520-19300542 CCGCTCCCAGCGCTGCCGCCAGA No data
Right 1114092063 14:19300549-19300571 GGCTGCGCTCCCCCAGGCAAAGG No data
1114092057_1114092063 0 Left 1114092057 14:19300526-19300548 CCAGCGCTGCCGCCAGAGCTCCA No data
Right 1114092063 14:19300549-19300571 GGCTGCGCTCCCCCAGGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114092063 Original CRISPR GGCTGCGCTCCCCCAGGCAA AGG Intergenic