ID: 1114092065

View in Genome Browser
Species Human (GRCh38)
Location 14:19300558-19300580
Sequence CCCCCAGGCAAAGGCGCCAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114092060_1114092065 -3 Left 1114092060 14:19300538-19300560 CCAGAGCTCCAGGCTGCGCTCCC No data
Right 1114092065 14:19300558-19300580 CCCCCAGGCAAAGGCGCCACCGG No data
1114092057_1114092065 9 Left 1114092057 14:19300526-19300548 CCAGCGCTGCCGCCAGAGCTCCA No data
Right 1114092065 14:19300558-19300580 CCCCCAGGCAAAGGCGCCACCGG No data
1114092050_1114092065 30 Left 1114092050 14:19300505-19300527 CCAGCCTCCGAGGCCCCGCTCCC No data
Right 1114092065 14:19300558-19300580 CCCCCAGGCAAAGGCGCCACCGG No data
1114092055_1114092065 15 Left 1114092055 14:19300520-19300542 CCGCTCCCAGCGCTGCCGCCAGA No data
Right 1114092065 14:19300558-19300580 CCCCCAGGCAAAGGCGCCACCGG No data
1114092051_1114092065 26 Left 1114092051 14:19300509-19300531 CCTCCGAGGCCCCGCTCCCAGCG No data
Right 1114092065 14:19300558-19300580 CCCCCAGGCAAAGGCGCCACCGG No data
1114092056_1114092065 10 Left 1114092056 14:19300525-19300547 CCCAGCGCTGCCGCCAGAGCTCC No data
Right 1114092065 14:19300558-19300580 CCCCCAGGCAAAGGCGCCACCGG No data
1114092059_1114092065 0 Left 1114092059 14:19300535-19300557 CCGCCAGAGCTCCAGGCTGCGCT No data
Right 1114092065 14:19300558-19300580 CCCCCAGGCAAAGGCGCCACCGG No data
1114092054_1114092065 16 Left 1114092054 14:19300519-19300541 CCCGCTCCCAGCGCTGCCGCCAG No data
Right 1114092065 14:19300558-19300580 CCCCCAGGCAAAGGCGCCACCGG No data
1114092053_1114092065 17 Left 1114092053 14:19300518-19300540 CCCCGCTCCCAGCGCTGCCGCCA No data
Right 1114092065 14:19300558-19300580 CCCCCAGGCAAAGGCGCCACCGG No data
1114092052_1114092065 23 Left 1114092052 14:19300512-19300534 CCGAGGCCCCGCTCCCAGCGCTG No data
Right 1114092065 14:19300558-19300580 CCCCCAGGCAAAGGCGCCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114092065 Original CRISPR CCCCCAGGCAAAGGCGCCAC CGG Intergenic