ID: 1114092532

View in Genome Browser
Species Human (GRCh38)
Location 14:19302445-19302467
Sequence TGCGACTCGGGACCCCCAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114092517_1114092532 23 Left 1114092517 14:19302399-19302421 CCCAGGGCGTTCCCTCCGGATCG No data
Right 1114092532 14:19302445-19302467 TGCGACTCGGGACCCCCAGCCGG No data
1114092515_1114092532 29 Left 1114092515 14:19302393-19302415 CCGCAGCCCAGGGCGTTCCCTCC No data
Right 1114092532 14:19302445-19302467 TGCGACTCGGGACCCCCAGCCGG No data
1114092529_1114092532 -4 Left 1114092529 14:19302426-19302448 CCAGGGCTTGCGGGGCGTGTGCG No data
Right 1114092532 14:19302445-19302467 TGCGACTCGGGACCCCCAGCCGG No data
1114092523_1114092532 12 Left 1114092523 14:19302410-19302432 CCCTCCGGATCGGTGGCCAGGGC No data
Right 1114092532 14:19302445-19302467 TGCGACTCGGGACCCCCAGCCGG No data
1114092525_1114092532 8 Left 1114092525 14:19302414-19302436 CCGGATCGGTGGCCAGGGCTTGC No data
Right 1114092532 14:19302445-19302467 TGCGACTCGGGACCCCCAGCCGG No data
1114092518_1114092532 22 Left 1114092518 14:19302400-19302422 CCAGGGCGTTCCCTCCGGATCGG No data
Right 1114092532 14:19302445-19302467 TGCGACTCGGGACCCCCAGCCGG No data
1114092524_1114092532 11 Left 1114092524 14:19302411-19302433 CCTCCGGATCGGTGGCCAGGGCT No data
Right 1114092532 14:19302445-19302467 TGCGACTCGGGACCCCCAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114092532 Original CRISPR TGCGACTCGGGACCCCCAGC CGG Intergenic
No off target data available for this crispr