ID: 1114095223

View in Genome Browser
Species Human (GRCh38)
Location 14:19330463-19330485
Sequence GGGTGGGTCATTTCAAAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114095223_1114095230 0 Left 1114095223 14:19330463-19330485 CCTCACTTTGAAATGACCCACCC No data
Right 1114095230 14:19330486-19330508 CATGTCCGTCCGCACATGGTTGG No data
1114095223_1114095226 -4 Left 1114095223 14:19330463-19330485 CCTCACTTTGAAATGACCCACCC No data
Right 1114095226 14:19330482-19330504 ACCCCATGTCCGTCCGCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114095223 Original CRISPR GGGTGGGTCATTTCAAAGTG AGG (reversed) Intergenic
No off target data available for this crispr