ID: 1114095230

View in Genome Browser
Species Human (GRCh38)
Location 14:19330486-19330508
Sequence CATGTCCGTCCGCACATGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114095222_1114095230 12 Left 1114095222 14:19330451-19330473 CCAGGTTGACTACCTCACTTTGA No data
Right 1114095230 14:19330486-19330508 CATGTCCGTCCGCACATGGTTGG No data
1114095223_1114095230 0 Left 1114095223 14:19330463-19330485 CCTCACTTTGAAATGACCCACCC No data
Right 1114095230 14:19330486-19330508 CATGTCCGTCCGCACATGGTTGG No data
1114095220_1114095230 24 Left 1114095220 14:19330439-19330461 CCAGTCTAGGGCCCAGGTTGACT No data
Right 1114095230 14:19330486-19330508 CATGTCCGTCCGCACATGGTTGG No data
1114095221_1114095230 13 Left 1114095221 14:19330450-19330472 CCCAGGTTGACTACCTCACTTTG No data
Right 1114095230 14:19330486-19330508 CATGTCCGTCCGCACATGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114095230 Original CRISPR CATGTCCGTCCGCACATGGT TGG Intergenic
No off target data available for this crispr