ID: 1114097942

View in Genome Browser
Species Human (GRCh38)
Location 14:19351968-19351990
Sequence CTCAGCCAGCACTAAAAGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114097942_1114097944 -5 Left 1114097942 14:19351968-19351990 CCCAACTTTTAGTGCTGGCTGAG No data
Right 1114097944 14:19351986-19352008 CTGAGTTGTCGATTTGTTGCTGG No data
1114097942_1114097946 0 Left 1114097942 14:19351968-19351990 CCCAACTTTTAGTGCTGGCTGAG No data
Right 1114097946 14:19351991-19352013 TTGTCGATTTGTTGCTGGGATGG No data
1114097942_1114097945 -4 Left 1114097942 14:19351968-19351990 CCCAACTTTTAGTGCTGGCTGAG No data
Right 1114097945 14:19351987-19352009 TGAGTTGTCGATTTGTTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114097942 Original CRISPR CTCAGCCAGCACTAAAAGTT GGG (reversed) Intergenic
No off target data available for this crispr