ID: 1114097945

View in Genome Browser
Species Human (GRCh38)
Location 14:19351987-19352009
Sequence TGAGTTGTCGATTTGTTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114097943_1114097945 -5 Left 1114097943 14:19351969-19351991 CCAACTTTTAGTGCTGGCTGAGT No data
Right 1114097945 14:19351987-19352009 TGAGTTGTCGATTTGTTGCTGGG No data
1114097939_1114097945 29 Left 1114097939 14:19351935-19351957 CCTTGATACATTTTTCTTTTAAT No data
Right 1114097945 14:19351987-19352009 TGAGTTGTCGATTTGTTGCTGGG No data
1114097942_1114097945 -4 Left 1114097942 14:19351968-19351990 CCCAACTTTTAGTGCTGGCTGAG No data
Right 1114097945 14:19351987-19352009 TGAGTTGTCGATTTGTTGCTGGG No data
1114097941_1114097945 -3 Left 1114097941 14:19351967-19351989 CCCCAACTTTTAGTGCTGGCTGA No data
Right 1114097945 14:19351987-19352009 TGAGTTGTCGATTTGTTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114097945 Original CRISPR TGAGTTGTCGATTTGTTGCT GGG Intergenic
No off target data available for this crispr