ID: 1114097946

View in Genome Browser
Species Human (GRCh38)
Location 14:19351991-19352013
Sequence TTGTCGATTTGTTGCTGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114097943_1114097946 -1 Left 1114097943 14:19351969-19351991 CCAACTTTTAGTGCTGGCTGAGT No data
Right 1114097946 14:19351991-19352013 TTGTCGATTTGTTGCTGGGATGG No data
1114097941_1114097946 1 Left 1114097941 14:19351967-19351989 CCCCAACTTTTAGTGCTGGCTGA No data
Right 1114097946 14:19351991-19352013 TTGTCGATTTGTTGCTGGGATGG No data
1114097942_1114097946 0 Left 1114097942 14:19351968-19351990 CCCAACTTTTAGTGCTGGCTGAG No data
Right 1114097946 14:19351991-19352013 TTGTCGATTTGTTGCTGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114097946 Original CRISPR TTGTCGATTTGTTGCTGGGA TGG Intergenic
No off target data available for this crispr