ID: 1114099298

View in Genome Browser
Species Human (GRCh38)
Location 14:19362601-19362623
Sequence GTCCTCCCGTGCCATAGTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114099298_1114099303 10 Left 1114099298 14:19362601-19362623 CCTACACTATGGCACGGGAGGAC No data
Right 1114099303 14:19362634-19362656 TGTGCTCTGGACTCCAGCACCGG No data
1114099298_1114099304 13 Left 1114099298 14:19362601-19362623 CCTACACTATGGCACGGGAGGAC No data
Right 1114099304 14:19362637-19362659 GCTCTGGACTCCAGCACCGGAGG No data
1114099298_1114099306 25 Left 1114099298 14:19362601-19362623 CCTACACTATGGCACGGGAGGAC No data
Right 1114099306 14:19362649-19362671 AGCACCGGAGGACTCCTACACGG No data
1114099298_1114099307 28 Left 1114099298 14:19362601-19362623 CCTACACTATGGCACGGGAGGAC No data
Right 1114099307 14:19362652-19362674 ACCGGAGGACTCCTACACGGAGG No data
1114099298_1114099299 -3 Left 1114099298 14:19362601-19362623 CCTACACTATGGCACGGGAGGAC No data
Right 1114099299 14:19362621-19362643 GACCCAGCCTCACTGTGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114099298 Original CRISPR GTCCTCCCGTGCCATAGTGT AGG (reversed) Intergenic
No off target data available for this crispr