ID: 1114106995

View in Genome Browser
Species Human (GRCh38)
Location 14:19436935-19436957
Sequence GTGTCCCAGGGCACCCTCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114106988_1114106995 -1 Left 1114106988 14:19436913-19436935 CCAACCTCTTCCCACCAGCTTTG No data
Right 1114106995 14:19436935-19436957 GTGTCCCAGGGCACCCTCAGTGG No data
1114106989_1114106995 -5 Left 1114106989 14:19436917-19436939 CCTCTTCCCACCAGCTTTGTGTC No data
Right 1114106995 14:19436935-19436957 GTGTCCCAGGGCACCCTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114106995 Original CRISPR GTGTCCCAGGGCACCCTCAG TGG Intergenic
No off target data available for this crispr