ID: 1114107406

View in Genome Browser
Species Human (GRCh38)
Location 14:19439963-19439985
Sequence TAGAAAATGCAGAAGTAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114107404_1114107406 -1 Left 1114107404 14:19439941-19439963 CCTAGCTTTCACCTAGACAAGTT No data
Right 1114107406 14:19439963-19439985 TAGAAAATGCAGAAGTAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114107406 Original CRISPR TAGAAAATGCAGAAGTAGCC TGG Intergenic
No off target data available for this crispr